ID: 1145352606

View in Genome Browser
Species Human (GRCh38)
Location 17:22098843-22098865
Sequence CAGAAGGGCTGGAGGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145352600_1145352606 2 Left 1145352600 17:22098818-22098840 CCTCATGGATGATATGAGTGTGT No data
Right 1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145352606 Original CRISPR CAGAAGGGCTGGAGGGAATT AGG Intergenic
No off target data available for this crispr