ID: 1145361109

View in Genome Browser
Species Human (GRCh38)
Location 17:22213165-22213187
Sequence TCCCAATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145361109_1145361112 8 Left 1145361109 17:22213165-22213187 CCAGCACTCCCTCAACATTGGGA No data
Right 1145361112 17:22213196-22213218 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145361109 Original CRISPR TCCCAATGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr