ID: 1145366685

View in Genome Browser
Species Human (GRCh38)
Location 17:22271371-22271393
Sequence CCTGACACTGGACTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145366685_1145366695 27 Left 1145366685 17:22271371-22271393 CCCCAACAAAGTCCAGTGTCAGG No data
Right 1145366695 17:22271421-22271443 ATATTTTCCAGCAGCATTTTGGG No data
1145366685_1145366694 26 Left 1145366685 17:22271371-22271393 CCCCAACAAAGTCCAGTGTCAGG No data
Right 1145366694 17:22271420-22271442 TATATTTTCCAGCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145366685 Original CRISPR CCTGACACTGGACTTTGTTG GGG (reversed) Intergenic
No off target data available for this crispr