ID: 1145367625

View in Genome Browser
Species Human (GRCh38)
Location 17:22278196-22278218
Sequence GGCCCAGCTGTGCCTCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 2, 3: 111, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145367625_1145367629 7 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367629 17:22278226-22278248 CAAGAGCCAAGCCACATTCTAGG 0: 1
1: 0
2: 2
3: 14
4: 195
1145367625_1145367630 8 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367630 17:22278227-22278249 AAGAGCCAAGCCACATTCTAGGG 0: 1
1: 1
2: 1
3: 14
4: 157
1145367625_1145367636 26 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367636 17:22278245-22278267 TAGGGGCTTCCAGGATCCGTGGG 0: 1
1: 0
2: 1
3: 3
4: 77
1145367625_1145367631 9 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367631 17:22278228-22278250 AGAGCCAAGCCACATTCTAGGGG 0: 1
1: 1
2: 0
3: 13
4: 166
1145367625_1145367635 25 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367635 17:22278244-22278266 CTAGGGGCTTCCAGGATCCGTGG 0: 1
1: 0
2: 2
3: 12
4: 136
1145367625_1145367633 17 Left 1145367625 17:22278196-22278218 CCTGATGGAGGCACAGCTGGGCC 0: 1
1: 1
2: 2
3: 111
4: 296
Right 1145367633 17:22278236-22278258 GCCACATTCTAGGGGCTTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145367625 Original CRISPR GGCCCAGCTGTGCCTCCATC AGG (reversed) Intergenic
900326074 1:2109300-2109322 CGTCCGGCAGTGCCTCCATCTGG - Intronic
900345203 1:2207210-2207232 TGCCCAGCTCTGCCCCCACCAGG - Intronic
900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG + Intronic
900891584 1:5453694-5453716 GGCCCAGCCCTGCATCCACCAGG + Intergenic
900898377 1:5500067-5500089 GGCCCTGCTGTGGCTCCCACAGG - Intergenic
901240965 1:7692953-7692975 AACCCCTCTGTGCCTCCATCTGG + Intronic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
904415879 1:30360841-30360863 GTCCCAGCTCTGCCACCAACTGG - Intergenic
904702427 1:32365902-32365924 AGCCCAGCTGTGCCACCTGCAGG - Intronic
906794881 1:48688938-48688960 GGCCCAGCTTGGCATCTATCAGG + Intronic
906933718 1:50193778-50193800 GTCCGAGCTCTGCCTCAATCAGG + Exonic
907285347 1:53376352-53376374 GGCACAGCTGGGGCGCCATCTGG - Intergenic
907842615 1:58171877-58171899 GGCCCAGCTTTGCCTACAGCAGG + Intronic
908300679 1:62758502-62758524 GGCCCAGCTTTGCCTATAGCAGG + Intergenic
909018278 1:70403507-70403529 GGCCCAGCTGTGGTTCCTGCAGG - Intergenic
909027129 1:70494975-70494997 GGCCCAGCTGTGACCCCTGCAGG + Intergenic
910217083 1:84853663-84853685 GGACCAGCTCTGCCTCTCTCTGG + Intronic
910397180 1:86804920-86804942 GGCCCAGCTTTGCCCACAGCAGG - Intergenic
911056980 1:93717270-93717292 GGCTCAGCTGGGCCTCCTTCTGG - Intronic
911440870 1:97923995-97924017 TGTCAAGCTGTCCCTCCATCTGG + Intergenic
913469799 1:119176545-119176567 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
915093060 1:153439795-153439817 GGCCCGGCTCTGCCACCAGCCGG - Intronic
915191540 1:154154852-154154874 AGCCCCGCTGGGCCTCCAGCAGG + Exonic
915260839 1:154675718-154675740 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
915304879 1:154971330-154971352 GGCCCTGCTCTGCATCCATTGGG - Intronic
915932761 1:160070195-160070217 GGCCCAGCTCTGCCCCCGGCCGG - Exonic
916114707 1:161476812-161476834 GGCCCAGCTTTGCCTACAGGAGG + Intergenic
916750292 1:167717319-167717341 GGCTAAGCTGTGCCTACATACGG + Intergenic
916939800 1:169666256-169666278 GGCCCAGCTTTGCCTACCGCAGG + Intronic
918172183 1:182008762-182008784 GCACCAGCTGTGAATCCATCTGG - Intergenic
919780630 1:201218583-201218605 GTCACAGCTGTGGCTCCCTCAGG + Exonic
921019964 1:211226433-211226455 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
921049562 1:211501328-211501350 GGCCCACCTGTGACTGCATGGGG + Intergenic
922701226 1:227762274-227762296 GGGGCAGCTGTGCCTCCAGAGGG + Intronic
922962574 1:229661436-229661458 GGCCCTGCAGTGCCACCACCAGG - Intergenic
923198961 1:231693757-231693779 GGCCCAGCTGGAACTGCATCTGG - Intronic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
1063129027 10:3161651-3161673 GGCCCGGCTGTGCGTGCATTAGG + Intronic
1064603293 10:17014601-17014623 GACCCAGCTTTGCCTACAGCAGG - Intronic
1066614310 10:37280405-37280427 GGCCCAGCTTTGCCAACAGCAGG - Intronic
1067750688 10:48969298-48969320 GGGCCATCTCTGCCTCCAGCTGG - Intronic
1069137069 10:64780572-64780594 GGCCCAGCTTTGCCTATAGCAGG - Intergenic
1069574360 10:69516410-69516432 GCCCCAGCAGTGCCTCCACCTGG + Intergenic
1069580111 10:69560016-69560038 GGCCCAGGTGTGCCTGGCTCTGG - Intergenic
1070049663 10:72875860-72875882 GGACCAGCCGTCCCACCATCTGG + Intronic
1070886493 10:79904665-79904687 GGACCAAATGTGCCTCCTTCTGG + Intergenic
1072371390 10:94769132-94769154 GGCCCAGCTTTGCCTACAGCAGG - Intronic
1073420475 10:103420209-103420231 CGCCCAGCTGTGTGACCATCTGG + Intronic
1075021523 10:118956059-118956081 GATCCAGCTGTGCCTCAAGCTGG + Intergenic
1076052653 10:127347740-127347762 GGCTCAGCACTGCCTCCATCTGG + Intronic
1076063795 10:127432530-127432552 GTCCCAGATGTGCCAACATCTGG + Intronic
1076268469 10:129129826-129129848 GACCCCCCTGTGACTCCATCTGG + Intergenic
1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG + Intronic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1077194042 11:1270486-1270508 GGCCCTGCTGTCCTTCCCTCTGG + Intergenic
1077360743 11:2139274-2139296 TGCCCACCAGCGCCTCCATCGGG - Intronic
1077469105 11:2748511-2748533 GGCCCAGCTGGGCGTCCACGTGG + Intronic
1077663108 11:4086508-4086530 GGCCATGCTGTGGCTCCGTCAGG - Exonic
1078147282 11:8730506-8730528 GGCCCAGCCGTTTCTCCAGCCGG + Exonic
1079104968 11:17564841-17564863 GGCTCAGCTCTGCCTCCTGCTGG - Intronic
1079730938 11:23937345-23937367 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1079811395 11:25003072-25003094 GGCCCAGCTTTGCCTACAGCAGG - Intronic
1080418857 11:32092694-32092716 TCCCCAGCCCTGCCTCCATCTGG - Intronic
1080852130 11:36078920-36078942 GTCCCAGCTGTGCCATCAGCTGG + Intronic
1081421711 11:42879205-42879227 GGCCCAGTTTTGCCTACAGCAGG + Intergenic
1081606657 11:44531373-44531395 GGCACAGCTGCAACTCCATCTGG + Intergenic
1083355389 11:62062447-62062469 GTCCCAGCAATGCCTCCAACAGG + Intergenic
1083627665 11:64079785-64079807 GACCCAGCTGTACCTCCAGATGG - Intronic
1084179255 11:67438399-67438421 GGCCCAGCTGCTCCTCCAGGCGG + Exonic
1084211288 11:67624256-67624278 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1084649930 11:70483172-70483194 GTCCCAGCTCTGCCTCCTGCTGG + Intronic
1085324990 11:75599740-75599762 AGGCCAGCTGAGCCTCCTTCAGG + Intronic
1086317670 11:85610730-85610752 GGCCCAGCTTTGCCTACAGCAGG + Intronic
1087075261 11:94122411-94122433 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1088492814 11:110403620-110403642 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1089324552 11:117648216-117648238 TGCCCAGCTGTGTGTCCATGGGG + Intronic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1090247485 11:125226853-125226875 GGCCCAGCTGTCCCATCCTCAGG + Intronic
1091324929 11:134678967-134678989 GTCCCAGCTCTGCCTCCTACTGG - Intergenic
1092331057 12:7588559-7588581 GGCTCATCTGTGCCTGCATGAGG + Intergenic
1092472592 12:8792506-8792528 GGCCCAGCTTTCCCTACAGCAGG + Intergenic
1093289353 12:17301934-17301956 GGCACAGCTATTCTTCCATCTGG - Intergenic
1093345528 12:18035516-18035538 GGCCCAGCTTCGCCTACAGCAGG + Intergenic
1095043413 12:37470442-37470464 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1095738698 12:45585548-45585570 TGCCCAGCTGTCACCCCATCTGG - Intergenic
1096180667 12:49548873-49548895 GGCCCTGCTGTTCCCCCCTCAGG + Exonic
1096614942 12:52826926-52826948 GGCCCAGCAGTGCCTCCGTGGGG - Intronic
1097169392 12:57104432-57104454 GGCCCAGCCCTGCCCCAATCTGG - Intronic
1101779787 12:107824940-107824962 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1103341323 12:120222657-120222679 GGCCCAGCTTTGCCTCCCAAGGG + Exonic
1103480479 12:121247194-121247216 GGTCCAAGTGTGCCTCCATTAGG + Intronic
1104730887 12:131104737-131104759 GGACCAGCTGTGCACCCACCTGG + Intronic
1105505910 13:21009695-21009717 GTAGCAGCTGTTCCTCCATCTGG - Intronic
1105762765 13:23529071-23529093 GACCCAGCTTTGCCTACAGCAGG + Intergenic
1105999088 13:25702732-25702754 GGCATAGCTGGGTCTCCATCTGG + Intronic
1106216737 13:27708479-27708501 GCCACAGCTGTGCCTCTACCTGG - Intergenic
1107435353 13:40376572-40376594 GGCCAAGCTGTGGCTCCAGCAGG + Intergenic
1108587011 13:51878978-51879000 GGCCCAGCAGAGCCTCCCTTAGG + Intergenic
1109910559 13:68905486-68905508 GGTCCAGCTGTGACTCCAAAAGG + Intergenic
1110906467 13:80896751-80896773 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1112519413 13:100082508-100082530 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1112538665 13:100285027-100285049 GCCCCAGCTTTGCCTACAGCAGG + Intronic
1112762817 13:102710149-102710171 GGCGAAGCTGTGGCTCCATGGGG + Intergenic
1113203651 13:107893078-107893100 GGCCCAGCTTTGCCTAATTCAGG - Intergenic
1113450098 13:110402953-110402975 GCCCCAGCTGTGGCTCCAGTGGG - Intronic
1113551217 13:111194551-111194573 GGCCCAGCTTTGCCTATAGCAGG - Intronic
1117546444 14:56797927-56797949 GGCCCAGCTGGGCCTGCCTCGGG - Intergenic
1117589789 14:57255532-57255554 GCTTCAGCTGTGCCTTCATCAGG - Intronic
1118005690 14:61562642-61562664 GGCCCTGTGGTGCCTCCACCTGG + Intronic
1121154021 14:91666153-91666175 GGCCCAGCTTTGCCTACAGCAGG + Intronic
1122074988 14:99230219-99230241 TGCAGAGCTGTGGCTCCATCAGG + Intronic
1122597805 14:102905214-102905236 GGCTCAGCTGGGACTCCAGCAGG - Exonic
1122767991 14:104085016-104085038 GGTCCAGCTCTGCCTGCCTCTGG + Intergenic
1122985254 14:105208872-105208894 GGCCCACCTGCACCTCCCTCGGG + Intergenic
1202941958 14_KI270725v1_random:158054-158076 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1124698908 15:31894171-31894193 TGGACAACTGTGCCTCCATCAGG + Intergenic
1125217304 15:37289955-37289977 GCCCCAGCTGTGGCTCAAACAGG - Intergenic
1126291494 15:47085410-47085432 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1127559973 15:60126616-60126638 GTCCCAGGTTTGCCTCCAGCTGG + Intergenic
1128481632 15:68045372-68045394 AGCCCAGCTCTGCCTCCTCCTGG - Intergenic
1128556557 15:68635674-68635696 GGCCCAACTTTTCCTCCATGTGG - Intronic
1129458803 15:75689672-75689694 TGCGCAGCTCAGCCTCCATCAGG + Exonic
1129725003 15:77897220-77897242 TGCGCAGCTCAGCCTCCATCAGG - Intergenic
1130065002 15:80595825-80595847 GGGCCACCTCTGCCTCCAGCAGG + Exonic
1130207226 15:81888254-81888276 GGCCCAGCTGAGGCTCCGTGTGG + Intergenic
1130667336 15:85880708-85880730 GGCACAGCTGCTCCTCCTTCTGG + Intergenic
1130959344 15:88649430-88649452 TGCCCAGCTGTGGCTGCCTCTGG + Intronic
1131396168 15:92088088-92088110 GTCCCAGCTCTGCCACCAACTGG + Intronic
1132232485 15:100194213-100194235 TGCCCACCTGTGTCTCAATCAGG - Intronic
1132493482 16:247923-247945 GGCCCCGCAGTGCCTCCATGGGG - Intronic
1133138417 16:3728239-3728261 GTCCCATCTGAGCCGCCATCTGG + Exonic
1133258260 16:4531971-4531993 GGCCCCGCTGGGCCTCTAGCAGG + Intronic
1134038429 16:11049751-11049773 GGCCTAGCTCTGCCCCCAGCAGG + Intronic
1134261374 16:12653744-12653766 AGCCCAGCCGTGCATCCATGAGG - Intergenic
1134374512 16:13659419-13659441 GGCCCAGCTCAGGCTGCATCAGG - Intergenic
1134422982 16:14111910-14111932 TGCTCAGCTGTCCCTCCATACGG + Intronic
1135339394 16:21633242-21633264 GGCCCAGCTTTGCCTACAGCAGG - Intronic
1136004386 16:27318734-27318756 TGCCCAGCTGGGCTTGCATCTGG + Intronic
1137376304 16:47955123-47955145 GGACCAGCCGAGCCTTCATCTGG - Intergenic
1138121977 16:54407799-54407821 GCCCAAGCTGTTCCTTCATCAGG + Intergenic
1140453252 16:75088654-75088676 GGGCCAGCTCTGCCTCTTTCTGG + Intronic
1140772890 16:78222291-78222313 GGCCCAGCTGTGCCTCATTAGGG + Intronic
1140911169 16:79454388-79454410 AGACCAGCTGTGCCTCCCTCAGG + Intergenic
1141638524 16:85328397-85328419 GCCCCCGCTGTGCCTTTATCTGG - Intergenic
1141688889 16:85585542-85585564 TGCCCAGCTGGGTCTCCATGTGG + Intergenic
1143027032 17:3947026-3947048 GGCCAAGCTGGGCCTGGATCCGG - Intronic
1143107077 17:4535260-4535282 GGCCCAGCAGTGCCGGCATTTGG + Intronic
1143148210 17:4789996-4790018 GTCCCAGCTCTGCCTCCACCGGG + Exonic
1143509318 17:7386816-7386838 GGGCCAGCAGTGGCTCCAGCAGG - Intronic
1144827810 17:18116204-18116226 AGCCCAGCTGGGCCTCCAACAGG - Intronic
1145248324 17:21284270-21284292 GGCCCAGCCGTGCCACCTTTAGG + Intergenic
1145296164 17:21593866-21593888 GGCCCATCTGTGCCTCCATCAGG + Intergenic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1145993094 17:29090908-29090930 GGCTCAGCTGCTCCTCCAGCTGG + Exonic
1146195208 17:30806136-30806158 GTCCCAGCTCTGCCTCCTACAGG - Intronic
1146358970 17:32159117-32159139 GTCCCAGCTGCGCCTTCAGCCGG - Intronic
1148100382 17:45086699-45086721 GCCTCAGCTGTGCCTTCATGAGG + Intronic
1148463385 17:47850764-47850786 CGCCCAGTTTTCCCTCCATCGGG + Intronic
1148956279 17:51356187-51356209 GGAACAGCTCTGCCTCCCTCAGG + Intergenic
1149209965 17:54290725-54290747 GGCCCAGCTCTGCCTACAACAGG + Intergenic
1150223054 17:63508003-63508025 GGCCCAGGTGTGCCTGAATGAGG + Intronic
1151354205 17:73548865-73548887 GGCCCAGCCCAGCCTCCTTCTGG + Intronic
1151568303 17:74912589-74912611 GGCCCAGCCTTGCCTACAGCAGG + Intergenic
1151697939 17:75727581-75727603 GGCCGGGCTGGGCCCCCATCGGG + Intronic
1151954949 17:77375528-77375550 TGCCCCCATGTGCCTCCATCTGG + Intronic
1152690597 17:81716130-81716152 GACCCAGCTGAGGCTCCAGCAGG + Intronic
1152735275 17:81994192-81994214 GGTCCAGCTGTGCCTCCTGCGGG + Intronic
1157521071 18:48345814-48345836 GGCCCAGCTCTGCTGCCATCTGG + Intronic
1157857290 18:51114627-51114649 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1157976729 18:52336277-52336299 CTCCCAGCAGTGCCTCCATGAGG + Intergenic
1159065053 18:63560254-63560276 GAGCAAGCTGTGTCTCCATCTGG + Intronic
1160915143 19:1492868-1492890 GGCCCGGCTGTGCCTGCCCCCGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161448009 19:4328769-4328791 GGAGCAGTTGTGCCTCCAGCCGG + Exonic
1161454531 19:4363425-4363447 AGTCCAGCTGTGCATCCACCAGG + Exonic
1162028722 19:7908375-7908397 GGCCCAGCATTGCCCCTATCTGG - Intronic
1162108177 19:8383695-8383717 GGCCCAGCTTTGCCTACAGCAGG + Intronic
1162327110 19:10006019-10006041 GGCCCAGCAGTGCCTCCCTCCGG + Intronic
1162720308 19:12658111-12658133 GGCCCACCAGCGCCTCCAGCTGG + Exonic
1163451195 19:17378476-17378498 CCCCCAGCAGTGCCTCCAGCAGG - Intergenic
1163713592 19:18861390-18861412 GGCACAGCTCTGCCTCCATGAGG + Intronic
1163739040 19:18999500-18999522 GGTCCTGCTGTGCCCTCATCTGG + Intronic
1164186227 19:22871754-22871776 GGCCCGGCCGTGACCCCATCTGG - Intergenic
1164538464 19:29104447-29104469 GGGACAGCTGTGCCTACATTTGG - Intergenic
1164767801 19:30785035-30785057 GGCCAAGCTGGGGCGCCATCTGG - Intergenic
1165490428 19:36120241-36120263 GGCCCAGCTGGGCCTCATGCTGG - Intronic
1165847358 19:38826944-38826966 GGCCCAGCTTTGCCTACAGCAGG + Intronic
1166099890 19:40565657-40565679 TGTCCAGCTGTGCCTGGATCTGG - Exonic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925891501 2:8438624-8438646 GGCCCAGGGGTGCATGCATCAGG - Intergenic
925949618 2:8898478-8898500 GGCCCAGCTTTGCCTACAGCAGG - Intronic
926002579 2:9345738-9345760 TGCCCAGCTCTGCCTTCACCAGG - Intronic
926155034 2:10448728-10448750 TGCACAGCTGTGCTTCCACCTGG + Intergenic
926166296 2:10523646-10523668 GTCCCACCTGTGCCTCCAGAGGG - Intergenic
927148468 2:20181958-20181980 GGCCAAGCGCTGCCGCCATCTGG - Intergenic
928617343 2:33053755-33053777 GGCCCTGCTTTGCCTACAGCAGG - Intronic
928986325 2:37185925-37185947 GTCTCAGCTGAGCCTTCATCAGG + Intronic
930038807 2:47104820-47104842 GGCCCAGCTTTGCCTACAGCAGG + Intronic
932497585 2:72154054-72154076 GGCCAGGCTGTGCCTGCATCTGG - Intergenic
932562784 2:72887576-72887598 CGCCCAGCTCGGCCTCCAGCTGG - Exonic
932589897 2:73059030-73059052 GGTCCAGCTCTGCCTCCAGGGGG + Intronic
934314554 2:91904865-91904887 AGCTCAGCTGTGAATCCATCTGG - Intergenic
934640469 2:96024526-96024548 GGCCCTGCTGCGCATCCGTCAGG - Exonic
934867396 2:97825328-97825350 GGCCCAGCTTTGCCTACAGCAGG + Intronic
937122748 2:119452079-119452101 TGCCCAGCTGTCCCTCCCTTAGG - Exonic
937203356 2:120220062-120220084 AGCCCAGCTGTAGCTCCCTCAGG + Intergenic
938375037 2:130799323-130799345 GGCCCTGCTGTGCCCCCAGAAGG - Intergenic
938377954 2:130820751-130820773 GGCCCCGCTATGCCTCCTTGGGG - Intergenic
938805921 2:134807186-134807208 AGCCCAGCTTTGCCTACAGCAGG - Intergenic
939110036 2:137995553-137995575 GACTCAGCTGTGAATCCATCTGG - Intronic
939852125 2:147315603-147315625 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
940057019 2:149524405-149524427 AACTCAGCTGTGACTCCATCTGG + Intergenic
942140574 2:172973486-172973508 GCCCCACCTGTGCCCCTATCTGG - Intronic
942408767 2:175684604-175684626 GTCCCACCTCTGGCTCCATCAGG + Intergenic
943134023 2:183889666-183889688 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
944429368 2:199616808-199616830 GGCCCAGCATATCCTCCATCAGG + Intergenic
944729275 2:202501139-202501161 GGCCCAGCTTTGCCTACAGCAGG + Intronic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
948858935 2:240743578-240743600 GGCCCAGCTGTGCCACACCCTGG - Intronic
1168888742 20:1279899-1279921 GGCACAGCTGTGCCTTCCTGTGG + Intronic
1168892631 20:1304950-1304972 GGGCCAGCTGGGCCTCCACGCGG - Exonic
1170163907 20:13343309-13343331 AGCCAAGCTGTGCCTCCCTCAGG - Intergenic
1170462199 20:16587939-16587961 GGTCCAGCCTTGCCTCAATCTGG - Intergenic
1170890135 20:20369011-20369033 GGCCCCGCGGCGCCTCCACCGGG - Exonic
1170937520 20:20823028-20823050 GCCCCAGCTGTGCCTTCAGAAGG + Intergenic
1171537870 20:25913200-25913222 GGCCCAGCTGTGTCTCAAGTAGG + Intergenic
1171803318 20:29648603-29648625 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1171840803 20:30208511-30208533 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1172502066 20:35434475-35434497 GGCCCAGCTGTGCCTGGAGCTGG - Exonic
1173281481 20:41632058-41632080 GACCCAGCTGTGGCTAAATCTGG + Intergenic
1173676434 20:44839656-44839678 GTCGCAGCTCTGCCTCTATCTGG - Intergenic
1174347849 20:49944311-49944333 GGCCCACCTCAGCCTCCCTCAGG + Intronic
1175074331 20:56360273-56360295 AGCCCAGCTGTTCCTTCCTCCGG + Intronic
1176029440 20:63004983-63005005 CTCCCAGCTCTGCCACCATCCGG - Intergenic
1176044840 20:63087188-63087210 AGCCCAGCTGTGGCTGCACCAGG + Intergenic
1176581210 21:8528880-8528902 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1179583711 21:42361531-42361553 CTCCCACCTGTCCCTCCATCTGG - Intergenic
1181468638 22:23124729-23124751 GTCCCAGCAGGGCCTCCCTCAGG - Exonic
1181673562 22:24437423-24437445 GGCTCAGCTGTGATTCCATTTGG + Intronic
1182280422 22:29215072-29215094 GCCCAAACTGTGCCTCCACCTGG - Intronic
1182413924 22:30209039-30209061 GGCCCAGCTGGGCCTCCTACCGG - Intergenic
1182518331 22:30871460-30871482 GGCCCAGATGTGCCGCCCTGGGG - Intronic
1182837549 22:33356399-33356421 ATCCCAGCTGTGCCACCAACCGG + Intronic
1183191365 22:36323829-36323851 GGCCCTGCTGACCCTCCTTCAGG - Intronic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1184090385 22:42290131-42290153 GGCCCAGCCCTGCCTCCTGCTGG - Intronic
1184680511 22:46070399-46070421 GGGCCAGCAGTGTCGCCATCGGG + Intronic
1185077160 22:48689708-48689730 AGCCCAGCTGTGCTTTCATGGGG + Intronic
1185165140 22:49256950-49256972 GGCCCAGCTGTGCTGGCATCTGG - Intergenic
950293006 3:11802589-11802611 AGTTCAGCTGTGACTCCATCAGG - Intronic
950502244 3:13371969-13371991 GGCCCACACGTGCCTCCACCTGG + Exonic
951583887 3:24195660-24195682 GGCCCCACTGAGCCTCCCTCTGG + Intronic
952402815 3:32978609-32978631 GGCCAAGCAAGGCCTCCATCAGG - Intergenic
952453303 3:33450871-33450893 GGCCCAGCTTTGCCTATATCAGG + Intergenic
954100386 3:48367877-48367899 AGCCCAGCTGTGCCTCTCTTTGG - Intergenic
954438315 3:50507820-50507842 TACCCAGCTCTGCCTCCACCTGG + Intergenic
955365423 3:58306319-58306341 GGCCCAGCTGTGGCTGCTGCCGG + Exonic
956746867 3:72317401-72317423 GGCCCAGCAGATCCTCCACCTGG + Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
961339378 3:126207277-126207299 GGCCCAGCTGAGCCTTCAGGTGG - Intergenic
961455013 3:127019729-127019751 GGGCCAGCTCTGCCTCTGTCAGG - Intronic
964064768 3:152564055-152564077 GGCCCAGCTTAGCCTACAGCAGG + Intergenic
965139458 3:164815716-164815738 GGCCCAGCTTTGCCCACAGCAGG + Intergenic
966851033 3:184165058-184165080 GGCCCAGCCCTGCCCCCATGAGG - Intronic
967583924 3:191189991-191190013 GGCCCAGTTTTGCCTACAGCAGG + Intergenic
968276726 3:197445957-197445979 GGCCCCGCTGTGGTTGCATCAGG - Intergenic
968576303 4:1367815-1367837 GCCCCAGCTGTGCCCTCATCGGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
968949873 4:3684902-3684924 GGCCCTTCTATTCCTCCATCAGG + Intergenic
969457269 4:7307214-7307236 GGCACAGCAGTGCCTTTATCTGG - Intronic
969609009 4:8216758-8216780 GTCCCAGCTCTGCCTCCATGTGG - Intronic
970451251 4:16168487-16168509 GTGCCTGCTGTTCCTCCATCAGG + Intronic
970558983 4:17264221-17264243 GGCCCTGCTGTGCCTTGTTCTGG - Intergenic
971280933 4:25242150-25242172 GGCCCAGCTTTGCCTACAGCAGG - Intronic
971677867 4:29657200-29657222 GGCCCAGCTGTGTTTCTTTCCGG - Intergenic
973046107 4:45535665-45535687 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
974174767 4:58308586-58308608 GGCCCAGCTTTGCCTACAGGAGG + Intergenic
974187584 4:58462322-58462344 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
974526809 4:63057080-63057102 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
974838598 4:67278071-67278093 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
975595560 4:76045951-76045973 GGCCCAGCTTTGCCTACAGCAGG - Intronic
975655308 4:76635503-76635525 GGTCTGGCTGTCCCTCCATCAGG - Intronic
975892946 4:79050727-79050749 GGACCATCTGTGCCCCCAGCTGG - Intergenic
976969981 4:91092676-91092698 GGCACAGCTATTCTTCCATCTGG + Intronic
977834679 4:101634049-101634071 GGCTCAGCTATGCCTACAGCAGG - Intronic
977884342 4:102239534-102239556 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
980290647 4:130844994-130845016 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
982701377 4:158662216-158662238 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
983692013 4:170482054-170482076 GCCCCAGCTGTGCTTCCCTGGGG - Intergenic
983834684 4:172372956-172372978 AGCCCAGCTTTGCCTGCAGCAGG - Intronic
984917705 4:184738672-184738694 GGCCCAGCCTTGCCTACAACAGG + Intergenic
985529979 5:428445-428467 GGCACAGCTGCCCCTCCAGCTGG + Intronic
985572941 5:660021-660043 GGCCCTGCTGTTCCTCCTGCAGG - Exonic
987930142 5:24391392-24391414 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
988591752 5:32555626-32555648 GGCCCAGGTTTGCCTACAGCAGG - Intronic
989957592 5:50374571-50374593 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
991236001 5:64398278-64398300 GGTTTAGCTGTGTCTCCATCTGG + Intergenic
992049623 5:72930545-72930567 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
992455450 5:76911734-76911756 GGCCCAGCTTTGCCTATAGCAGG + Intronic
995706679 5:114994620-114994642 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
996680463 5:126224405-126224427 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
999110412 5:149115723-149115745 GGCCCTGCTGTGCCTCTCTGAGG + Intergenic
999176066 5:149632503-149632525 GTCTTAGCTGTGCCTGCATCCGG + Exonic
999856130 5:155596216-155596238 GGCTCAGTTGTGGCTCCAACGGG + Intergenic
1000085483 5:157884293-157884315 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1001518005 5:172370309-172370331 GGTGCAACTGTGCCACCATCAGG - Intronic
1001563194 5:172683537-172683559 GGCCCAGCTTGGCCACCACCTGG - Exonic
1002189784 5:177472563-177472585 GGCCCAGCTCCTCCCCCATCAGG + Intronic
1002535768 5:179874568-179874590 TGCCCAGCTGTGCCACCAACTGG + Intronic
1002601597 5:180356893-180356915 AGCCCAGCTCTGCCTGAATCTGG + Intergenic
1003989285 6:11469960-11469982 GGCCCTGCTGTGCCTCTCCCTGG + Intergenic
1004459350 6:15821028-15821050 GGCACCACTGTGTCTCCATCTGG + Intergenic
1004462189 6:15848013-15848035 GTCCCAGCTGTGCCTCTTCCTGG - Intergenic
1004812495 6:19275456-19275478 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1005947096 6:30602667-30602689 GGCCCACCAGGGCCTCCATGGGG + Exonic
1006479939 6:34283999-34284021 GGCTCAGCCTTGCCTCCATCAGG - Exonic
1006512904 6:34531349-34531371 GGCACATCTGAGCCTTCATCCGG - Intronic
1006723060 6:36172694-36172716 GAGCCAGCTGTGCCTCCAATTGG + Intergenic
1006991812 6:38221453-38221475 GGCCCATGTGTCCCTTCATCTGG - Intronic
1007993089 6:46277699-46277721 GCCCCATCTATGCCTCCCTCTGG - Intronic
1009407468 6:63329016-63329038 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1010270063 6:73908034-73908056 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1011374806 6:86677151-86677173 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1011923947 6:92618237-92618259 GGCCTATCTGTGCCCCCACCTGG - Intergenic
1012441300 6:99264571-99264593 GGCCCAGCTTTGCCTACAGCGGG - Intergenic
1013391152 6:109687680-109687702 GGCTGAGATGTGCTTCCATCTGG - Intronic
1016894768 6:149041086-149041108 GGCCCAGCTGCCTCTCCCTCAGG - Intronic
1017101198 6:150851279-150851301 GGCCCAGCTTTGCCTACAACAGG + Intergenic
1017525941 6:155241423-155241445 GGCCCGGCTTTGCCTCCCTCTGG + Intronic
1017955050 6:159170134-159170156 AGCCCTGCTCTGCCTCCCTCCGG - Intronic
1018043431 6:159945213-159945235 GTCCCAGCTGTGGCTCAAGCAGG + Intergenic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019328542 7:451705-451727 GGCCCAACTGTCCCTCCCCCAGG - Intergenic
1020213631 7:6172570-6172592 GCCCATCCTGTGCCTCCATCAGG + Intronic
1020533746 7:9367644-9367666 GACTCAGCTGTGAATCCATCTGG - Intergenic
1021756484 7:23857867-23857889 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023627297 7:42128909-42128931 GGCCCACCTCTGCCACCTTCTGG - Intronic
1024870544 7:53958473-53958495 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1025289321 7:57700029-57700051 GGTCCAGCTGTGTCTCAAGCAGG + Intergenic
1027420795 7:78015798-78015820 GGGCCAGATGTGGCTGCATCTGG + Intergenic
1028494988 7:91452095-91452117 GGCCCAGCTTTGCCTACAGTAGG - Intergenic
1029435161 7:100559962-100559984 GGCCATGCTGTGCCTCCCTGTGG - Intronic
1029877883 7:103773023-103773045 GGCCCAGCAGTGCCTCCTTTGGG - Intronic
1031732023 7:125312080-125312102 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1032491977 7:132330602-132330624 GCCCCAACTGTGTCTGCATCTGG + Intronic
1033758995 7:144420685-144420707 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1033993029 7:147311379-147311401 GCCTCAGCTGTGCAACCATCTGG - Intronic
1034579727 7:152032031-152032053 GGCCCAGCTTTGCCTACAGCAGG - Intronic
1035551513 8:531127-531149 TGCCAAGCTGTGCCACCTTCAGG + Intronic
1035714973 8:1747048-1747070 GTCCCAGCTGGGCCTGGATCTGG - Intergenic
1036155370 8:6337354-6337376 TGCCCAGGTGTGCCTCGGTCTGG - Intergenic
1038639032 8:29309207-29309229 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1039692949 8:39881259-39881281 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1039791049 8:40875791-40875813 CGCCCTTCTGTGCATCCATCTGG + Intronic
1039999446 8:42563918-42563940 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1040579252 8:48682891-48682913 AGCCCAGCTGTGCCTCCCTCAGG - Intergenic
1040667635 8:49652775-49652797 GTCCCAGCTTTGCCTACAGCAGG - Intergenic
1040953646 8:52958887-52958909 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1040964823 8:53072860-53072882 GGCTCAGCTTTGCCTACAGCAGG - Intergenic
1041002151 8:53463820-53463842 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG + Intergenic
1042215773 8:66428874-66428896 GGGCCAGCTCCGCCTCTATCTGG + Intergenic
1044527960 8:93273516-93273538 GCCCCAGCCGTGGCTCCAACAGG - Intergenic
1048329966 8:133464683-133464705 GGTCCTGCTGTGCCTCCACCGGG - Intronic
1048456880 8:134586560-134586582 GGGCCCTCTGTGCTTCCATCAGG + Intronic
1049346030 8:142139125-142139147 GGCCCAGGTGTCCTCCCATCAGG - Intergenic
1049784542 8:144444201-144444223 GGCCGCGCTGTGCCACCAGCTGG - Exonic
1051935510 9:22438782-22438804 GGCCCAGCTTTGCCTATAGCAGG + Intergenic
1052057541 9:23921635-23921657 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1052289745 9:26827595-26827617 GGCCCAGCTTTGCCTACAGCTGG + Intergenic
1052413506 9:28149418-28149440 TGCCCAGCTGCCCCACCATCTGG + Intronic
1052997465 9:34558942-34558964 AGCCCAGCTGTCCCACCCTCAGG + Intronic
1056392542 9:86153043-86153065 GGCTCAGCTTTGCCTACAACGGG - Intergenic
1056713580 9:89010580-89010602 GGCCCTGCTGTCCCTCCAATGGG - Intergenic
1056714910 9:89020931-89020953 GGCCCATGTGTGCCACCATAGGG - Intronic
1057161923 9:92895127-92895149 GGCCCAGCTGGGCCTCATCCTGG - Intergenic
1061179243 9:129014166-129014188 GGACCAGCAGTGCCCCCAGCTGG - Intronic
1061187642 9:129063941-129063963 AGCCCAGGTGTTCCTCCATCAGG - Intronic
1062014980 9:134286860-134286882 GCCCCAGCTCTGCCACCCTCTGG + Intergenic
1062165218 9:135104261-135104283 GCTCCAGCTGTCCCTCCACCTGG - Intronic
1062400047 9:136368391-136368413 GATCCAGCTGTGCCCCCATGGGG - Intronic
1062504976 9:136868814-136868836 GTCCCATCTGGCCCTCCATCGGG + Intronic
1203776586 EBV:76449-76471 TGACCAGCTTTGCCTCCATCTGG + Intergenic
1203611228 Un_KI270749v1:6925-6947 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1188505390 X:30877078-30877100 GCCCCTGCTGCCCCTCCATCAGG - Intronic
1191843922 X:65532391-65532413 GGAGCAACTGTGCCTCCTTCAGG + Intronic
1191898952 X:66021906-66021928 GGCAGAGCTGAGCCTCCCTCGGG + Exonic
1192230005 X:69257939-69257961 GGCCCTGCGGTGCCCCCATCTGG - Intergenic
1192739991 X:73882645-73882667 TGCCCAGCTGCCACTCCATCTGG + Intergenic
1195439808 X:104886991-104887013 GGCCCAGCTTTTCCTACAGCAGG + Intronic
1195738016 X:108033444-108033466 AGCCCAGCTGTGCTTACACCTGG - Intergenic
1197513642 X:127399251-127399273 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1198414427 X:136405529-136405551 GTCCCAGCTCTGCCTCCAGTTGG + Intronic
1198600861 X:138283014-138283036 TGCCCAGCCGTGACCCCATCTGG - Intergenic
1199832166 X:151557982-151558004 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1200527791 Y:4295638-4295660 TGCCTAGCTGTGACCCCATCTGG + Intergenic
1200880598 Y:8208170-8208192 GGCACAGCTTTGCCTACAGCAGG - Intergenic
1200959514 Y:8984109-8984131 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1201403991 Y:13632116-13632138 GACCAAGCTTTGCCTACATCAGG + Intergenic
1201429916 Y:13893170-13893192 GGCCCAGCTTTGCCTACGGCAGG + Intergenic
1201487799 Y:14510556-14510578 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1201631469 Y:16075492-16075514 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1201729373 Y:17188397-17188419 GGCCCAGCTTTGCCTACAGCAGG - Intergenic
1202243097 Y:22790388-22790410 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1202271808 Y:23080692-23080714 GGCCCAGCTTTGCCTAGAGCAGG - Intergenic
1202294218 Y:23339990-23340012 GGCCCAGCTTTGCCTAGAGCAGG + Intergenic
1202396084 Y:24424138-24424160 GGCCCAGCTTTGCCTACAGCAGG + Intergenic
1202424805 Y:24714436-24714458 GGCCCAGCTTTGCCTAGAGCAGG - Intergenic
1202445984 Y:24955649-24955671 GGCCCAGCTTTGCCTAGAGCAGG + Intergenic
1202474701 Y:25245954-25245976 GGCCCAGCTTTGCCTACAGCAGG - Intergenic