ID: 1145386082

View in Genome Browser
Species Human (GRCh38)
Location 17:22412468-22412490
Sequence CTCTGGACAAGTCACCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 8, 3: 26, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145386080_1145386082 -1 Left 1145386080 17:22412446-22412468 CCTGTCACTGGAACACTGGTCTC 0: 1
1: 2
2: 21
3: 40
4: 129
Right 1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG 0: 1
1: 1
2: 8
3: 26
4: 114
1145386079_1145386082 0 Left 1145386079 17:22412445-22412467 CCCTGTCACTGGAACACTGGTCT 0: 1
1: 3
2: 20
3: 37
4: 171
Right 1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG 0: 1
1: 1
2: 8
3: 26
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145386082 Original CRISPR CTCTGGACAAGTCACCAGTT TGG Intergenic
900537821 1:3187483-3187505 CTCTGGAGAAGTCCCCAGCCAGG + Intronic
905444063 1:38013411-38013433 AACTGGACAAGTCACCACTCTGG - Intronic
905508787 1:38502151-38502173 CTCTGGACCAGTAACTAGATAGG - Intergenic
908035026 1:60042606-60042628 CTCTGTACAAGGCACCACATGGG + Intronic
909744725 1:79079981-79080003 TTCTGGATGAGTCATCAGTTTGG + Intergenic
913936869 1:125063833-125063855 CTCTGGACAAGCCACCCTTTAGG - Intergenic
913937477 1:125067434-125067456 CTCTGGACAAGCCACCCTTTAGG + Intergenic
915341073 1:155177137-155177159 CTCTGCAGAAGCCAGCAGTTGGG - Intronic
915962095 1:160275356-160275378 CTCTGGGCATGCCACCATTTAGG - Intergenic
917742751 1:177976753-177976775 TTCTGCACAAGTCATCAGTAAGG + Intronic
920031051 1:203037711-203037733 CACTGCAGAAGTCACCAGTGAGG - Intronic
921578357 1:216864815-216864837 CTCTGGAGAGGTCAGGAGTTTGG + Intronic
922454306 1:225762544-225762566 CTCTGGATAAGACACCAGTGAGG + Intergenic
923488071 1:234455389-234455411 GACTGGACAACTCAACAGTTCGG + Intronic
923794541 1:237141568-237141590 CTCTGGACATCTTCCCAGTTGGG - Intronic
1068679835 10:59807779-59807801 CTCTGCTCTAGACACCAGTTTGG + Intronic
1069245220 10:66196421-66196443 CTATGGCCAAGCAACCAGTTGGG - Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072947009 10:99819459-99819481 AGCAGGATAAGTCACCAGTTTGG - Intronic
1073848352 10:107585729-107585751 GTCTGGGCAAGTCACCTGTGTGG + Intergenic
1076709310 10:132322866-132322888 CTCTGGCCCAGGGACCAGTTTGG + Intronic
1076866056 10:133166967-133166989 CTCTGCACGAGTCCACAGTTGGG + Intronic
1076982504 11:212356-212378 CTCTGTGCCAGTCACAAGTTAGG + Intronic
1078062483 11:8056930-8056952 CTCTCCACACGTCACGAGTTAGG + Intronic
1078666717 11:13331890-13331912 CTCTGGAGAAGTCACCTGTTGGG + Intronic
1079105191 11:17567192-17567214 CTCTGGACATGTCACCTGTGTGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1085414934 11:76313561-76313583 CTATGGAAAAGGCACCAGCTGGG - Intergenic
1095038260 12:37418119-37418141 CTCCGGACAAGCCACCCTTTTGG - Intergenic
1095038727 12:37420550-37420572 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1095039101 12:37422518-37422540 CTCAGGACAAGTCACCCGTTTGG - Intergenic
1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG + Intergenic
1096204015 12:49706814-49706836 CTTAGGAGAAGTCCCCAGTTCGG - Intronic
1097504414 12:60446943-60446965 CTTTGGAAAAGTCACCATCTGGG - Intergenic
1099940973 12:89187759-89187781 ATCTGCAAAAGTTACCAGTTAGG - Intergenic
1103613530 12:122138288-122138310 CTCTTGGCAACTCACCAGCTTGG - Exonic
1109837284 13:67876823-67876845 CTCTGTACAAGTCACATGGTAGG - Intergenic
1110148744 13:72224781-72224803 CTCTGGACAGGGGACCAGTATGG + Intergenic
1114314712 14:21499010-21499032 CTCTGGTCACCTTACCAGTTGGG + Exonic
1115785208 14:36817697-36817719 CTGTGAACAAGTCAGCAGATGGG + Intronic
1117102763 14:52367293-52367315 CTCTGGAAAAAGCACCATTTTGG + Intergenic
1118839769 14:69501555-69501577 CTCTGGGCATGTCACCAGCACGG - Intronic
1121332277 14:93057128-93057150 CTCTGGGCAAGTCGCCTGTGAGG - Intronic
1121745209 14:96283580-96283602 TCCTGGACAAGTCATCCGTTTGG + Exonic
1126195709 15:45928088-45928110 CCCTTGACAACTCACCAGCTGGG - Intergenic
1126419614 15:48457547-48457569 CTTTGGACACCTCACCAGCTTGG + Intronic
1127632890 15:60842748-60842770 CTCTGCCCCAGGCACCAGTTTGG - Intronic
1128648014 15:69391189-69391211 TTCTGGAGAAGTTACCAGATGGG - Intronic
1136932628 16:34432794-34432816 TTCTGGCCAAGTCACCCGTTTGG + Intergenic
1136971944 16:34979020-34979042 TTCTGGCCAAGTCACCCGTTTGG - Intergenic
1139397451 16:66651583-66651605 CTCTGGATAAGTCATATGTTAGG - Intronic
1140888402 16:79264389-79264411 CAATGGCCAAGTCATCAGTTAGG + Intergenic
1141145818 16:81529409-81529431 CTCTGGATCTGTCAGCAGTTTGG + Intronic
1142164413 16:88578213-88578235 CTCTGGAGAGGGCACCAGCTGGG + Intronic
1143808828 17:9453894-9453916 GTCTGTAAAAGTCACCAGTCTGG + Intronic
1145306432 17:21677837-21677859 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1145369919 17:22299689-22299711 CTCTGAACAAGTTACCCTTTTGG + Intergenic
1145370581 17:22303513-22303535 TCCTGGCCAAGTCACCCGTTTGG + Intergenic
1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG + Intergenic
1146912408 17:36657198-36657220 CTCTGGACAGGTGACAAGTGGGG + Intergenic
1149552263 17:57549006-57549028 CTTTGGAAAAGTCAAAAGTTTGG - Intronic
1158884020 18:61808144-61808166 CAAAGGACAAGACACCAGTTTGG + Exonic
1160062903 18:75548872-75548894 CTCTGGGCTAATCCCCAGTTTGG + Intergenic
1162000299 19:7740467-7740489 CTCTGGAAATGTCACCTTTTCGG - Exonic
1162251281 19:9445760-9445782 ATCTGGACAATTACCCAGTTGGG + Intergenic
1165595458 19:37008691-37008713 TTCTGGACAAGTCACCCGTTTGG + Intronic
1165595879 19:37011005-37011027 CTCTGGACAAGTCACCTGTTTGG + Intronic
1165601814 19:37060368-37060390 CTTTGGACAAGTCACCCGTTTGG + Intronic
1165680865 19:37773988-37774010 TTCTGGACAAGGCTCCAATTTGG + Intronic
925030833 2:648981-649003 CTCAGGACAAGTCAGCAGCCAGG + Intergenic
929070315 2:38022488-38022510 CTCTTGAGAAGTTAGCAGTTTGG - Intronic
929612163 2:43279025-43279047 CTCTGGACAAGTGGCCATCTGGG - Intronic
932423015 2:71612504-71612526 CTCTGGGCCAGCCACCATTTTGG + Intronic
937072125 2:119072497-119072519 CTCTGGAGAAGTCACCCAATGGG + Intergenic
941087491 2:161134725-161134747 CTCTGGCCAAGTAGCTAGTTAGG - Intergenic
948628880 2:239288934-239288956 CTCTAGACAAGTCACAGCTTAGG + Intronic
1170093458 20:12617828-12617850 CTGGGGACAAGACACCAGGTGGG - Intergenic
1171523934 20:25795279-25795301 CTCTGGACAAGCCATCCCTTTGG - Intronic
1171524348 20:25797534-25797556 CTCTGGACAAGCCACCCTTTTGG - Intronic
1171531677 20:25857324-25857346 CGCTGGACAAGCCACCCTTTTGG - Intronic
1171533082 20:25864822-25864844 CTCTGGACAAGCCACGCTTTTGG - Intronic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1171552479 20:26058349-26058371 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171552893 20:26060604-26060626 CTCTGGACAAGCCATCCCTTTGG + Intergenic
1171573734 20:26277858-26277880 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171806831 20:29688382-29688404 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171837081 20:30167370-30167392 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1175681110 20:60989594-60989616 CTCTGGAAAAGTTAGCAGTCAGG - Intergenic
1176679226 21:9810276-9810298 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1179710880 21:43212325-43212347 CTCTGAACAACTCTGCAGTTTGG - Intergenic
949669770 3:6386238-6386260 TTCTGCAGATGTCACCAGTTTGG + Intergenic
952456125 3:33473560-33473582 CGCTGGTCAAGACATCAGTTGGG + Intergenic
955076538 3:55619032-55619054 CCCTGGAGAAGACACCTGTTGGG - Intronic
966037022 3:175431233-175431255 CTCTGTACACTTCACGAGTTGGG + Intronic
966620739 3:181961285-181961307 CTCTTCAGAGGTCACCAGTTAGG + Intergenic
970303804 4:14709733-14709755 CTCAGGAAAAGTAACCAGTGTGG + Intergenic
973809022 4:54552127-54552149 TTCTAGACAAGTCATCGGTTTGG - Intergenic
976398887 4:84585714-84585736 CTCAGCATAAGTCACCAGTCCGG - Intronic
985494769 5:198254-198276 CCCTGGACAAGGCTCCAGTAAGG - Exonic
985817290 5:2136216-2136238 CTCTGGAAATGTCACCAGAAGGG + Intergenic
990516295 5:56533984-56534006 CTTTGGATAAGTCACCTGCTGGG + Intronic
992931254 5:81648590-81648612 CTCTGGTGATCTCACCAGTTTGG - Intronic
993221820 5:85108838-85108860 CTGTGGACTAGTCAACAGATGGG + Intergenic
994253055 5:97559653-97559675 TTCTGGACAAATCAACATTTGGG - Intergenic
996127055 5:119738053-119738075 CTCTGGCCAAGTGTCCAGATGGG + Intergenic
998138887 5:139688942-139688964 CTGTGGACAGCTCCCCAGTTAGG - Intergenic
1002666009 5:180825608-180825630 CTCTGGACCAGTGACCACCTGGG + Intergenic
1004918964 6:20358183-20358205 CTCTGGACAAGTCAAAACTATGG - Intergenic
1011654558 6:89538761-89538783 CTCAGGATAAGAAACCAGTTTGG + Intronic
1015410509 6:132888702-132888724 CTATGGACAGGTCACCAATACGG - Intergenic
1015752436 6:136573871-136573893 CTCTGGGGAAGTAACCATTTGGG - Intronic
1019997687 7:4735219-4735241 CTCCAACCAAGTCACCAGTTTGG + Intronic
1020650754 7:10873008-10873030 CATTGGAAAAGTCATCAGTTTGG - Intergenic
1025284808 7:57652628-57652650 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1025285163 7:57654589-57654611 CTCAGGACAAGTCACCCGTTTGG - Intergenic
1025301154 7:57820635-57820657 CTCCGGACAAGCCACCCTTTGGG + Intergenic
1025301610 7:57823027-57823049 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1029017463 7:97329173-97329195 CTATAGGAAAGTCACCAGTTTGG + Intergenic
1029966290 7:104744179-104744201 CTCTGTACAAGTAAAGAGTTTGG + Intronic
1031478579 7:122251615-122251637 CTTTGGAAAAGTCTCTAGTTTGG - Intergenic
1037052328 8:14391572-14391594 TATTGGACAAGGCACCAGTTAGG + Intronic
1037122872 8:15310353-15310375 CTCTGGACAAGTGACAAGTGGGG - Intergenic
1038980438 8:32753611-32753633 CAAAGGACAAGTCACCATTTGGG + Intronic
1041327962 8:56689302-56689324 CTCAGGACCAGTCACCACTGTGG - Intergenic
1042207517 8:66344369-66344391 TTCTGGACAAGTCACCAAAATGG + Intergenic
1043972912 8:86552587-86552609 CTCTGGAAAAAGCATCAGTTTGG + Intronic
1044480078 8:92675671-92675693 CTTTGGACAAGTCACTTCTTTGG - Intergenic
1045540086 8:103075910-103075932 CTGGGGACAAGTGGCCAGTTAGG - Intergenic
1045649309 8:104327644-104327666 GACTGGTCGAGTCACCAGTTAGG + Intergenic
1053784556 9:41644986-41645008 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1053785138 9:41647796-41647818 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054159880 9:61666386-61666408 CTCTGGACAAGCCACCGTTTTGG + Intergenic
1054172522 9:61855136-61855158 CCCTGGACAAGCCACCCTTTAGG + Exonic
1054173283 9:61858924-61858946 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1054173864 9:61861746-61861768 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054447373 9:65384147-65384169 CTCTGGACAAGCCACCCTTTAGG + Intergenic
1054448141 9:65388008-65388030 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1054448720 9:65390812-65390834 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054663676 9:67719035-67719057 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1054664259 9:67721857-67721879 CCCTGGACAAGCCACCCTTTTGG - Intergenic
1054665018 9:67725665-67725687 CCCTGGACAAGCCACCCTTTAGG - Intergenic
1056968055 9:91180538-91180560 GCCTGGACAGGTCACCAGTGGGG - Intergenic
1057212093 9:93205947-93205969 CTCAGGTAAAGCCACCAGTTTGG + Intronic
1059976117 9:119718996-119719018 CCTTGGACAAGTCACCAGACAGG + Intergenic
1060556731 9:124511796-124511818 CTTTGGGAAAGTCCCCAGTTAGG - Intergenic
1203664398 Un_KI270754v1:12812-12834 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1186151358 X:6677809-6677831 TTCTGGACAAATCCCCAGCTGGG + Intergenic
1192356636 X:70410306-70410328 CTCTGGACAAGTCATCATTTTGG - Intronic
1195333054 X:103821668-103821690 GTCTGGACAATTCACCAGTCAGG + Intergenic
1197680152 X:129374244-129374266 TTCTGAACAAGTAACCAATTAGG - Intergenic