ID: 1145390159

View in Genome Browser
Species Human (GRCh38)
Location 17:22449397-22449419
Sequence CTTGAAAAGCAGGTAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145390155_1145390159 -8 Left 1145390155 17:22449382-22449404 CCAATAAACTGTGATCTTGAAAA No data
Right 1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145390159 Original CRISPR CTTGAAAAGCAGGTAGTGGA GGG Intergenic
No off target data available for this crispr