ID: 1145390887

View in Genome Browser
Species Human (GRCh38)
Location 17:22454598-22454620
Sequence CGGCGCAAGCAGCCGCGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145390876_1145390887 30 Left 1145390876 17:22454545-22454567 CCAGAGCGCCGGAGAGAAAACCT No data
Right 1145390887 17:22454598-22454620 CGGCGCAAGCAGCCGCGGATCGG No data
1145390877_1145390887 22 Left 1145390877 17:22454553-22454575 CCGGAGAGAAAACCTTAACAGTG No data
Right 1145390887 17:22454598-22454620 CGGCGCAAGCAGCCGCGGATCGG No data
1145390880_1145390887 10 Left 1145390880 17:22454565-22454587 CCTTAACAGTGCAGCCAGGTGGC No data
Right 1145390887 17:22454598-22454620 CGGCGCAAGCAGCCGCGGATCGG No data
1145390882_1145390887 -4 Left 1145390882 17:22454579-22454601 CCAGGTGGCGCCCAACAGCCGGC No data
Right 1145390887 17:22454598-22454620 CGGCGCAAGCAGCCGCGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145390887 Original CRISPR CGGCGCAAGCAGCCGCGGAT CGG Intergenic
No off target data available for this crispr