ID: 1145393874

View in Genome Browser
Species Human (GRCh38)
Location 17:22478537-22478559
Sequence TCTGCACACCACTGCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145393874_1145393882 15 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393882 17:22478575-22478597 TTGAGACTACAGAAGGAACAGGG No data
1145393874_1145393885 21 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393885 17:22478581-22478603 CTACAGAAGGAACAGGGGCTGGG No data
1145393874_1145393886 28 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393886 17:22478588-22478610 AGGAACAGGGGCTGGGATGATGG No data
1145393874_1145393878 8 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393878 17:22478568-22478590 TACCGCCTTGAGACTACAGAAGG No data
1145393874_1145393884 20 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393884 17:22478580-22478602 ACTACAGAAGGAACAGGGGCTGG No data
1145393874_1145393883 16 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393883 17:22478576-22478598 TGAGACTACAGAAGGAACAGGGG No data
1145393874_1145393881 14 Left 1145393874 17:22478537-22478559 CCAACCCCGCAGTGGTGTGCAGA No data
Right 1145393881 17:22478574-22478596 CTTGAGACTACAGAAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145393874 Original CRISPR TCTGCACACCACTGCGGGGT TGG (reversed) Intergenic
No off target data available for this crispr