ID: 1145394982

View in Genome Browser
Species Human (GRCh38)
Location 17:22487656-22487678
Sequence CAGCCTGGAGAGCTTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145394982_1145394989 4 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394989 17:22487683-22487705 AACAGGAGCAGTGGTTATGCTGG No data
1145394982_1145394990 5 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394990 17:22487684-22487706 ACAGGAGCAGTGGTTATGCTGGG No data
1145394982_1145394988 -5 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394988 17:22487674-22487696 GGCTGAGGGAACAGGAGCAGTGG No data
1145394982_1145394992 22 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394992 17:22487701-22487723 GCTGGGCAAAGTTGGAAGCAAGG No data
1145394982_1145394991 14 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394991 17:22487693-22487715 GTGGTTATGCTGGGCAAAGTTGG No data
1145394982_1145394993 23 Left 1145394982 17:22487656-22487678 CCCTGGGCAAGCTCTCCAGGCTG No data
Right 1145394993 17:22487702-22487724 CTGGGCAAAGTTGGAAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145394982 Original CRISPR CAGCCTGGAGAGCTTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr