ID: 1145396117

View in Genome Browser
Species Human (GRCh38)
Location 17:22496420-22496442
Sequence CCAAGGGTGTGGGGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145396109_1145396117 -10 Left 1145396109 17:22496407-22496429 CCTGGCCACACGTCCAAGGGTGT No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data
1145396106_1145396117 -1 Left 1145396106 17:22496398-22496420 CCAACATAGCCTGGCCACACGTC No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data
1145396101_1145396117 19 Left 1145396101 17:22496378-22496400 CCCCTGCCACTGAATAGATTCCA No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data
1145396104_1145396117 13 Left 1145396104 17:22496384-22496406 CCACTGAATAGATTCCAACATAG No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data
1145396103_1145396117 17 Left 1145396103 17:22496380-22496402 CCTGCCACTGAATAGATTCCAAC No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data
1145396102_1145396117 18 Left 1145396102 17:22496379-22496401 CCCTGCCACTGAATAGATTCCAA No data
Right 1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145396117 Original CRISPR CCAAGGGTGTGGGGGACAGA GGG Intergenic
No off target data available for this crispr