ID: 1145398732

View in Genome Browser
Species Human (GRCh38)
Location 17:22514879-22514901
Sequence AGAAGCCATCTGGACACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145398725_1145398732 14 Left 1145398725 17:22514842-22514864 CCAATCCAAGTTCTCTCAGACCT No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data
1145398722_1145398732 30 Left 1145398722 17:22514826-22514848 CCTCCAGTTCCTTTCTCCAATCC No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data
1145398724_1145398732 21 Left 1145398724 17:22514835-22514857 CCTTTCTCCAATCCAAGTTCTCT No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data
1145398728_1145398732 -6 Left 1145398728 17:22514862-22514884 CCTGTGGTGTCACTCCCAGAAGC No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data
1145398723_1145398732 27 Left 1145398723 17:22514829-22514851 CCAGTTCCTTTCTCCAATCCAAG No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data
1145398727_1145398732 9 Left 1145398727 17:22514847-22514869 CCAAGTTCTCTCAGACCTGTGGT No data
Right 1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145398732 Original CRISPR AGAAGCCATCTGGACACCCA AGG Intergenic
No off target data available for this crispr