ID: 1145399481

View in Genome Browser
Species Human (GRCh38)
Location 17:22519647-22519669
Sequence CATCATATGGAGATGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145399481_1145399485 -2 Left 1145399481 17:22519647-22519669 CCATCCAACATCTCCATATGATG 0: 1
1: 0
2: 7
3: 17
4: 168
Right 1145399485 17:22519668-22519690 TGGAACTTCAGCTTGCTTCTTGG 0: 1
1: 0
2: 1
3: 25
4: 238
1145399481_1145399487 28 Left 1145399481 17:22519647-22519669 CCATCCAACATCTCCATATGATG 0: 1
1: 0
2: 7
3: 17
4: 168
Right 1145399487 17:22519698-22519720 TTAACCCTTCAAATTATTACAGG 0: 1
1: 1
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145399481 Original CRISPR CATCATATGGAGATGTTGGA TGG (reversed) Intergenic
900824834 1:4918168-4918190 CATCTTATGTAGATGGTGGCAGG + Intergenic
900975919 1:6016261-6016283 CCTCACTCGGAGATGTTGGAGGG - Intronic
901468685 1:9440669-9440691 CCTAATATGGAGATGTTGGGAGG - Intergenic
909308951 1:74121287-74121309 CATGACATGGAAAAGTTGGATGG - Intronic
910236793 1:85045270-85045292 CCTCAGATGGAGATGTTTGCTGG + Exonic
910969588 1:92842373-92842395 AATTTTATGGAGATGTTGAAAGG + Exonic
911959694 1:104285446-104285468 CATCATGTGGAGAGGTTTGTTGG - Intergenic
913718563 1:121566043-121566065 CACCATATGAGGTTGTTGGATGG + Intergenic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
916757729 1:167789463-167789485 CATCTTCTGGGGATGTTTGAAGG + Exonic
917492771 1:175512494-175512516 CTCCATAGGGATATGTTGGAGGG - Intronic
919012009 1:191976611-191976633 CAACATAGGGATATGTTAGAAGG + Intergenic
921063552 1:211606870-211606892 CATCACTTGGAGATGTTGTAAGG - Intergenic
921274775 1:213508295-213508317 CATTATTTGGGGGTGTTGGAAGG + Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
924846110 1:247773932-247773954 TACCATATGGACATCTTGGAAGG - Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1069049363 10:63776439-63776461 CTTCAAATGGAGATGTGAGAAGG - Intergenic
1069601646 10:69711936-69711958 CATCATATGGATTGGATGGATGG - Intergenic
1070118371 10:73551223-73551245 CATCATATGGAGACATTTGTAGG - Intronic
1072266314 10:93731375-93731397 CATGTAATGGAGATGTTTGAGGG - Intergenic
1073369467 10:102974147-102974169 CTTCAGATGGAGGTGTGGGAGGG + Intronic
1073939398 10:108677749-108677771 CATCTTATGTAGATGATGGCAGG - Intergenic
1075300140 10:121314922-121314944 TATCCAATGGAGATGTTGCAAGG - Intergenic
1076298733 10:129407516-129407538 CATCCTATGGAGATTTTGGACGG - Intergenic
1079962319 11:26940116-26940138 CATCTTATGTAGATGGTGGCAGG + Intergenic
1084030136 11:66476274-66476296 CACCAGATGGACATGTTGGATGG + Exonic
1085364567 11:75927874-75927896 CATGATAAGAAGTTGTTGGAGGG + Intronic
1086533644 11:87816065-87816087 CATCATGTAGAGATGTTAGATGG + Intergenic
1087470056 11:98561684-98561706 AATCATGTGGACATGTTGAAAGG - Intergenic
1087563889 11:99828421-99828443 CATCATATGGTGAAGATGGAAGG + Intronic
1089973998 11:122716902-122716924 CACAATTTGGAGATGTTAGATGG + Intronic
1093443307 12:19225622-19225644 CATTATAAGGTGATGTTAGAGGG + Intronic
1098126253 12:67296740-67296762 AATCATTTAGAGATTTTGGAAGG + Intronic
1099186341 12:79519491-79519513 CATGGTATAGAGATGTTGTATGG - Intergenic
1110554703 13:76845733-76845755 TCTCATATGGAAATTTTGGAGGG + Intergenic
1111336714 13:86835637-86835659 CATCATATGTGGATGGTGGCAGG + Intergenic
1112056626 13:95694638-95694660 CATCATGTAGAGATGTTGGATGG - Intronic
1113508814 13:110835183-110835205 CACCATAGGGAGAAGTGGGATGG - Intergenic
1116865488 14:50028445-50028467 CCTCATGTGGAGATTTTGCAGGG - Intergenic
1117055142 14:51904486-51904508 CACCATACGGAGATGTTGTTGGG + Intronic
1117367404 14:55042828-55042850 CATGAAAAAGAGATGTTGGAAGG - Intronic
1118505852 14:66410917-66410939 CATCATATGCAAATATCGGAAGG - Intergenic
1120412640 14:84176486-84176508 CATCATATAGAAATATTCGATGG - Intergenic
1121151572 14:91640073-91640095 CATCGAATGAAGCTGTTGGAAGG - Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1127102384 15:55580538-55580560 TATCTCATGGAGTTGTTGGAAGG - Intronic
1127351272 15:58155029-58155051 CATCATGTAGAAATGTTGGATGG - Intronic
1128116556 15:65110942-65110964 CATCATGTGGAGAGGTAGGGTGG + Intronic
1128633795 15:69289901-69289923 CATCAGATGGGGGTGTTAGATGG + Intergenic
1129196200 15:73968336-73968358 GAACACATGGAGATGCTGGAGGG - Intergenic
1129619461 15:77130912-77130934 CATCTTATGGAGCTGTTGTTTGG - Intronic
1131031743 15:89192011-89192033 AAACATATGGAGATTTTGGTTGG - Intronic
1131608619 15:93936767-93936789 CATCATTTGCTGATTTTGGAGGG + Intergenic
1131915225 15:97257882-97257904 CATAATATAGAAATGTTGGCAGG + Intergenic
1133992519 16:10719671-10719693 CATCATGTGGAAATGTTGGACGG + Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1136167409 16:28464354-28464376 GATAATATGGAAATCTTGGAGGG - Intronic
1137355074 16:47754328-47754350 CATAAAACGGAGATGTTGAAAGG - Intergenic
1139364308 16:66424383-66424405 CATGGCATGGAGATGTTGGAAGG - Intergenic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1141226551 16:82121678-82121700 CATCATGTAGAAATGTTAGAGGG + Intergenic
1141349176 16:83276896-83276918 CATCTTACGTAGATGTTGGCAGG + Intronic
1141370045 16:83478521-83478543 CACCATATGAAAATGTGGGAGGG + Intronic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1149479659 17:56992653-56992675 CATCCCATGGAGTTGTTGTAAGG - Intronic
1153250747 18:3119159-3119181 CATCATAGGGAGTGGTTGGGTGG - Intronic
1154038891 18:10834356-10834378 CACCTTATGGAGTTGTTGGGAGG + Intronic
1156111754 18:33736016-33736038 CATCTTATGGAATTGTTGGGAGG - Intronic
1156127351 18:33922015-33922037 AATCATATGGGGAAGATGGAAGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1158597464 18:58828589-58828611 CATCACATGGAGCTGCTGGCTGG - Intergenic
1158634148 18:59141076-59141098 CATCATGTTGAGATGTGGGGTGG + Intronic
1163457023 19:17413050-17413072 GATCATCTGGAGATGTGTGAGGG + Intronic
1163777649 19:19227497-19227519 CATCATAGGGAGATCTGGGGAGG - Exonic
1165173781 19:33912425-33912447 CATCACATGGGGATGTGTGATGG + Intergenic
927064789 2:19460545-19460567 CATCACCTGGGGATGGTGGATGG - Intergenic
927255829 2:21040145-21040167 CATCTTATGTAGATGGTGGCTGG - Intronic
933478090 2:82818200-82818222 CATCATGTAGAAATGTTAGATGG - Intergenic
937117833 2:119421441-119421463 CATCATCTTGAGATGGTGCAGGG + Intergenic
937511061 2:122595371-122595393 GACCATATGGAGATGGTGGGTGG - Intergenic
938309886 2:130282749-130282771 CATCATATAGAGATATGAGATGG - Intergenic
938445031 2:131369620-131369642 CATCATATAGAGATATGAGATGG + Intergenic
940433735 2:153625810-153625832 CAGAATGAGGAGATGTTGGAGGG + Intergenic
940479108 2:154205671-154205693 CATCTTATGCAGATGCTGGCAGG + Intronic
940607465 2:155944877-155944899 AATCATATGGTGATATTAGAAGG + Intergenic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
943204607 2:184877408-184877430 CATCATGTGGAGATTTGAGAAGG + Intronic
944298846 2:198099269-198099291 TATCATTTAGAGATCTTGGAAGG + Intronic
945895903 2:215481476-215481498 AATCATATGTAGATGCTGGAGGG - Intergenic
946988029 2:225295947-225295969 CATCAAATGGAGATGCTGTGTGG - Intergenic
948936727 2:241170294-241170316 CAACAGAAGGAAATGTTGGATGG + Intronic
1169407591 20:5335781-5335803 CATCATATGGGCATTTTGAAGGG - Intergenic
1172508207 20:35479804-35479826 CATTCCATGGAGATGTTGAAAGG + Intronic
1178114090 21:29399173-29399195 CCTAATAGGGAGATGTTGAATGG - Intronic
1181337976 22:22155176-22155198 CATCATGGGGAGATGATGGTGGG + Intergenic
1184233151 22:43169198-43169220 AGTCATATGGAGACGTTGGCTGG - Intronic
1184242229 22:43217254-43217276 ATCCACATGGAGATGTTGGATGG - Intronic
1184312078 22:43652315-43652337 CATCTTATGTAGATGGTGGCAGG - Intronic
949213991 3:1542778-1542800 CATCATATGGATATTTTACAGGG - Intergenic
951630006 3:24709388-24709410 TATCAGATGGAGATTTTTGAAGG + Intergenic
952273036 3:31851380-31851402 CATCAAAGGTAGATGATGGAGGG - Intronic
954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957651238 3:83007957-83007979 CATCATATGGAGTTATTTGTGGG - Intergenic
960689141 3:120325730-120325752 CATCTTATGAAGATATTGTAAGG - Exonic
961795628 3:129406844-129406866 CTTCATTTGGAGATTTTGGTGGG + Intronic
962638053 3:137351147-137351169 CATCAGATAGAAAAGTTGGACGG - Intergenic
963821507 3:149899893-149899915 AATCAAATGGAGATATTGAATGG + Intronic
967223135 3:187266050-187266072 CATCATATCAACATGATGGAGGG + Intronic
968265711 3:197361392-197361414 CATCTTATGGGGATGGTGGCAGG - Intergenic
969212870 4:5701189-5701211 GATCAGAAGGAGATGTTTGAAGG - Intronic
969973024 4:11067423-11067445 CATCATGTGAAGATGAAGGAGGG - Intergenic
970947248 4:21709233-21709255 CATCATCTGTATATGTTGGCTGG - Intronic
972178408 4:36435969-36435991 CAGCTTAAGGAGATTTTGGACGG + Intergenic
972243382 4:37218564-37218586 CAACATAAGGAGATGTTGTGAGG - Intergenic
972734389 4:41826585-41826607 CATCATATGGTCATGCTGGCAGG - Intergenic
973031865 4:45353707-45353729 GCTCATTCGGAGATGTTGGAAGG - Intergenic
973746687 4:53970328-53970350 CATCTTAAGGAGATTTTGGGTGG + Intronic
974246108 4:59320707-59320729 TACCATATGGAGAAGTTGGCTGG - Intergenic
974555955 4:63447332-63447354 CATCTTATGTAGATGGTGGCAGG + Intergenic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
976200436 4:82572501-82572523 CATTAAATGGATATGTTGTATGG - Intergenic
977448177 4:97158584-97158606 CATCATATAGAAATGTTAGATGG - Intergenic
978233085 4:106424327-106424349 TATCATATGGATAAGTTTGAGGG - Intergenic
979923905 4:126536082-126536104 CAACATATGTATCTGTTGGAGGG - Intergenic
986088059 5:4472788-4472810 CAACAGCTGGAGATTTTGGAAGG + Intergenic
986521100 5:8619247-8619269 CATCATATAGAAATGTTAAATGG - Intergenic
989960031 5:50402017-50402039 CACCATATGAGGTTGTTGGATGG - Intronic
991967264 5:72105912-72105934 GATCAGATTGACATGTTGGATGG + Intergenic
993983447 5:94569609-94569631 CATCATGTGGAGATGTTAGATGG - Intronic
994305283 5:98195689-98195711 CAACATATGTAGATGTTTTATGG + Intergenic
994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG + Intergenic
997570536 5:134923958-134923980 CATCATGCGGAGATATTGGATGG + Intronic
999689734 5:154136379-154136401 CATCATCTGGGGATGGTAGAGGG - Intronic
999811756 5:155134071-155134093 TAACATATGGAGATGTTAGCTGG + Intergenic
999891751 5:155985512-155985534 CCTCATATTGAGATGTTCTAGGG + Intronic
1003697570 6:8426067-8426089 CATCATATGGCAATGTTAGCTGG + Intronic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1008883295 6:56404235-56404257 GATTATATGGAGAGGTTGGTTGG - Intergenic
1009906808 6:69879466-69879488 CATTTTCTGGAGATGTTGAAAGG + Intronic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1013285492 6:108677654-108677676 GATCACATAGTGATGTTGGATGG + Intronic
1013500731 6:110748585-110748607 CACCATATGAAGAAGTTGCAAGG + Intronic
1022304729 7:29136433-29136455 CACCATTTGGACAGGTTGGAGGG + Intronic
1022333257 7:29399696-29399718 CATAATAGGGAGATGGTGCATGG - Intronic
1023925930 7:44669637-44669659 CATCATATGAAGGGGGTGGAGGG + Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025226899 7:57173428-57173450 CATCATATAGAGATATTAGATGG - Intergenic
1025229966 7:57196709-57196731 CATCATATAGAGATATTAGATGG - Intergenic
1025555616 7:62304263-62304285 AATCAAATGGAGACGTTGAATGG + Intergenic
1026760231 7:73121186-73121208 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027036573 7:74930007-74930029 CACCCTATAGAGTTGTTGGAAGG - Intergenic
1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG + Intergenic
1027488228 7:78788403-78788425 AATAAAATGGAAATGTTGGATGG - Intronic
1027488261 7:78788799-78788821 CATCATATAAAGATGTTTCAAGG - Intronic
1027926203 7:84466996-84467018 CATCACATGCAGATGTATGAGGG - Intronic
1030766744 7:113419697-113419719 GATAATATGGAGATGATGGGTGG + Intergenic
1037434597 8:18849285-18849307 CATCATATAGAAATGATAGATGG - Intronic
1037484419 8:19334019-19334041 CATCAACTGCAGATGTAGGAAGG + Intronic
1038481279 8:27903404-27903426 CATCATATAGAAATGTTAGATGG + Intronic
1039307524 8:36278795-36278817 CGTCATATAGAAATATTGGATGG + Intergenic
1040377287 8:46838614-46838636 CATCATGTGGAAATGTTAGGTGG + Intergenic
1042447217 8:68899364-68899386 CATCATCTAGTGATGTGGGATGG + Intergenic
1043668638 8:82851650-82851672 CATTATATTGAGTTTTTGGAAGG + Intergenic
1046378450 8:113419471-113419493 CATCATCTGGTGATTTTTGAAGG + Intronic
1046604055 8:116351051-116351073 CATCACGTGGAGATGGTGGTGGG - Intergenic
1046647516 8:116802222-116802244 TAGGATATGGAGATATTGGAGGG + Intronic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1050848256 9:10251759-10251781 CATATTATGGAGAAGTTGCAAGG - Intronic
1051042242 9:12825609-12825631 CATCAAATAGAGATGCTGCAGGG - Intergenic
1051502134 9:17789392-17789414 CATCATCTAAAGAAGTTGGAGGG + Exonic
1052267538 9:26591508-26591530 CATCATATGTGGATGGTGGCAGG + Intergenic
1052918520 9:33943290-33943312 TTTCTTATGGAGATGATGGAAGG + Intronic
1053330750 9:37204978-37205000 CCCAATATGGAGATGTTGGGAGG + Intronic
1056661811 9:88549229-88549251 GAACCTATGGAGATGTTGGGAGG - Intronic
1056690777 9:88807039-88807061 CACCATTTTGAGATGGTGGAGGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1058326837 9:103708923-103708945 CATGTGAAGGAGATGTTGGATGG + Intergenic
1060403434 9:123361321-123361343 CATCTCATGGAGGTGTTGAAAGG - Intronic
1202630805 M:14816-14838 CATCATGCGGAGATGTTGGATGG - Intergenic
1186013963 X:5169581-5169603 CATCATATAGAGATATTAGATGG - Intergenic
1186878554 X:13841303-13841325 CTTGAAATGAAGATGTTGGAAGG - Intronic
1189579952 X:42395812-42395834 CATAATATGAAGAGGTTGGCAGG - Intergenic
1190381763 X:49845958-49845980 CAGCCTATGGAGATGTGGGATGG - Intergenic
1195918659 X:109960387-109960409 CATCACTGGGAGATGTGGGAAGG + Intergenic
1197459975 X:126729173-126729195 CATCATATAGAAATGTTAGATGG - Intergenic
1199435878 X:147812072-147812094 CATCATATTGAGAACTTAGAAGG - Intergenic
1200894826 Y:8364099-8364121 CATCATGTAGAAATGTTAGATGG - Intergenic
1200962290 Y:9006651-9006673 CATGATGTCTAGATGTTGGAAGG + Intergenic
1200981617 Y:9267861-9267883 CATGATGTCTAGATGTTGGAAGG - Intergenic