ID: 1145403758

View in Genome Browser
Species Human (GRCh38)
Location 17:22568935-22568957
Sequence TCCAGCTGGCCAGGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145403751_1145403758 -7 Left 1145403751 17:22568919-22568941 CCAGCCCCTGGCCAAGTCCAGCT No data
Right 1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG No data
1145403748_1145403758 24 Left 1145403748 17:22568888-22568910 CCTGGGGTGGGAGTGAGTGCCTT No data
Right 1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG No data
1145403749_1145403758 5 Left 1145403749 17:22568907-22568929 CCTTCACTGAAACCAGCCCCTGG No data
Right 1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145403758 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG Intergenic
No off target data available for this crispr