ID: 1145405294

View in Genome Browser
Species Human (GRCh38)
Location 17:22585055-22585077
Sequence TGGGATTTATTGGGAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145405285_1145405294 21 Left 1145405285 17:22585011-22585033 CCATGAAAAATTAGTCTTGCAGA No data
Right 1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145405294 Original CRISPR TGGGATTTATTGGGAAAAAA GGG Intergenic
No off target data available for this crispr