ID: 1145406825

View in Genome Browser
Species Human (GRCh38)
Location 17:22607005-22607027
Sequence TCGGAATGTTTATGATTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145406825_1145406829 5 Left 1145406825 17:22607005-22607027 CCAGTTAATCATAAACATTCCGA No data
Right 1145406829 17:22607033-22607055 TGAACCATCTAACAATGGAATGG No data
1145406825_1145406828 0 Left 1145406825 17:22607005-22607027 CCAGTTAATCATAAACATTCCGA No data
Right 1145406828 17:22607028-22607050 CAGGTTGAACCATCTAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145406825 Original CRISPR TCGGAATGTTTATGATTAAC TGG (reversed) Intergenic
No off target data available for this crispr