ID: 1145411337

View in Genome Browser
Species Human (GRCh38)
Location 17:22668869-22668891
Sequence AGATGTCAGCAGAAAATGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145411337_1145411342 -6 Left 1145411337 17:22668869-22668891 CCGGCCATTTTCTGCTGACATCT No data
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data
1145411337_1145411344 12 Left 1145411337 17:22668869-22668891 CCGGCCATTTTCTGCTGACATCT No data
Right 1145411344 17:22668904-22668926 TCAGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145411337 Original CRISPR AGATGTCAGCAGAAAATGGC CGG (reversed) Intergenic
No off target data available for this crispr