ID: 1145411342

View in Genome Browser
Species Human (GRCh38)
Location 17:22668886-22668908
Sequence ACATCTGCCTCTGGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145411331_1145411342 27 Left 1145411331 17:22668836-22668858 CCCAGGATGAAGGGAGGCAGTGA 0: 28
1: 52
2: 47
3: 116
4: 464
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data
1145411336_1145411342 -5 Left 1145411336 17:22668868-22668890 CCCGGCCATTTTCTGCTGACATC No data
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data
1145411332_1145411342 26 Left 1145411332 17:22668837-22668859 CCAGGATGAAGGGAGGCAGTGAG 0: 20
1: 55
2: 48
3: 164
4: 620
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data
1145411338_1145411342 -10 Left 1145411338 17:22668873-22668895 CCATTTTCTGCTGACATCTGCCT No data
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data
1145411337_1145411342 -6 Left 1145411337 17:22668869-22668891 CCGGCCATTTTCTGCTGACATCT No data
Right 1145411342 17:22668886-22668908 ACATCTGCCTCTGGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145411342 Original CRISPR ACATCTGCCTCTGGGGTCTC AGG Intergenic
No off target data available for this crispr