ID: 1145411344

View in Genome Browser
Species Human (GRCh38)
Location 17:22668904-22668926
Sequence TCAGGTATGATTTCATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145411336_1145411344 13 Left 1145411336 17:22668868-22668890 CCCGGCCATTTTCTGCTGACATC No data
Right 1145411344 17:22668904-22668926 TCAGGTATGATTTCATCACCTGG No data
1145411337_1145411344 12 Left 1145411337 17:22668869-22668891 CCGGCCATTTTCTGCTGACATCT No data
Right 1145411344 17:22668904-22668926 TCAGGTATGATTTCATCACCTGG No data
1145411338_1145411344 8 Left 1145411338 17:22668873-22668895 CCATTTTCTGCTGACATCTGCCT No data
Right 1145411344 17:22668904-22668926 TCAGGTATGATTTCATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145411344 Original CRISPR TCAGGTATGATTTCATCACC TGG Intergenic
No off target data available for this crispr