ID: 1145413940

View in Genome Browser
Species Human (GRCh38)
Location 17:22697210-22697232
Sequence AGTAATATGCAGAATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145413940_1145413942 -5 Left 1145413940 17:22697210-22697232 CCCTGCACATTCTGCATATTACT No data
Right 1145413942 17:22697228-22697250 TTACTGCTTAATCGTAAGCATGG No data
1145413940_1145413943 0 Left 1145413940 17:22697210-22697232 CCCTGCACATTCTGCATATTACT No data
Right 1145413943 17:22697233-22697255 GCTTAATCGTAAGCATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145413940 Original CRISPR AGTAATATGCAGAATGTGCA GGG (reversed) Intergenic
No off target data available for this crispr