ID: 1145688621

View in Genome Browser
Species Human (GRCh38)
Location 17:26706801-26706823
Sequence AAAGGAATATTCAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145688621_1145688626 23 Left 1145688621 17:26706801-26706823 CCCCCAGAGTTGAATATTCCTTT No data
Right 1145688626 17:26706847-26706869 CTTTTTGCAGAATCTGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145688621 Original CRISPR AAAGGAATATTCAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr