ID: 1145689474

View in Genome Browser
Species Human (GRCh38)
Location 17:26722935-26722957
Sequence CAGAGGACAGTGAGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 38, 2: 11, 3: 40, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145689468_1145689474 29 Left 1145689468 17:26722883-26722905 CCAAGAAATTAACTAGAGTCTTG 0: 27
1: 6
2: 4
3: 19
4: 155
Right 1145689474 17:26722935-26722957 CAGAGGACAGTGAGGTGGTCAGG 0: 1
1: 38
2: 11
3: 40
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145689474 Original CRISPR CAGAGGACAGTGAGGTGGTC AGG Intergenic
900559680 1:3297748-3297770 CAGGGGACAGGGAGGGAGTCAGG + Intronic
902058460 1:13621719-13621741 CAGAAGACTGTGAGATGGTACGG - Intergenic
903321627 1:22546843-22546865 CAGAGGGCCGTGAGGGGGCCTGG - Intergenic
903542012 1:24101874-24101896 AACAGGACAGTGGGGTGGCCTGG + Intronic
903933688 1:26879784-26879806 CAGAGGATGGGGAGCTGGTCTGG + Intronic
904273362 1:29364681-29364703 AACAGGGCAGTGAGTTGGTCTGG + Intergenic
905790254 1:40785673-40785695 GAGTGGACAGTCAGGTGGACAGG - Intronic
906476438 1:46172327-46172349 CAAAGAAAAGTGAGGTGGTAGGG + Intronic
906553048 1:46682313-46682335 CAGAGGAAGGTGTGGTGGACAGG + Intronic
906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG + Intronic
907243644 1:53093920-53093942 CAGGGCACAGTGAGATGGGCAGG - Intronic
910838877 1:91542338-91542360 CAGAGGACAGGGTGGTGGCTGGG - Intergenic
911377006 1:97063115-97063137 CAGAGGGTAGACAGGTGGTCAGG + Intergenic
912724975 1:112050879-112050901 ATGAGGCCAGAGAGGTGGTCAGG + Intergenic
913221301 1:116662808-116662830 CAGAGAAAAGTGAGATGGTTTGG - Intronic
913249349 1:116899472-116899494 TAGAAAACAGGGAGGTGGTCAGG + Intergenic
913700549 1:121369771-121369793 CAGAGGACAGGGATGAAGTCAGG + Intronic
913701908 1:121382481-121382503 TAGAGGGCTGTGAGGTGGTTAGG - Intronic
913941243 1:125109067-125109089 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
913956090 1:143295410-143295432 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
913981341 1:143520030-143520052 CAGAGGACAGTGAAGTGGCCAGG + Intergenic
914041099 1:144050229-144050251 CAGAGGACAGGGATGAAGTCAGG + Intergenic
914075714 1:144346685-144346707 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
914103464 1:144619811-144619833 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
914136988 1:144910247-144910269 CAGAGGACAGGGATGAAGTCAGG - Intronic
914985912 1:152457098-152457120 CGGAGGGGAGGGAGGTGGTCAGG - Intergenic
915935270 1:160086966-160086988 CAGAGGACTGTGAAGTGGGAGGG + Intronic
916628021 1:166580528-166580550 CAGAGGCCAGGGAAGTGGGCTGG + Intergenic
916674441 1:167054127-167054149 CACAGGACAGTGAGGTCAGCAGG + Exonic
916825135 1:168435585-168435607 CAGAGAACAGTGTGGTGACCAGG + Intergenic
919011646 1:191973322-191973344 CAGGGGAGAGTGATGTGGTTTGG - Intergenic
919469533 1:197961180-197961202 CACAGGAAAGTGAGGTGGGTGGG - Intergenic
920178858 1:204120312-204120334 AAGGGGACAGTGATCTGGTCGGG + Intronic
920487963 1:206388498-206388520 CAGAGGACAGGGATGAAGTCAGG + Intronic
921049868 1:211503643-211503665 CAGAGCCCAGTGAGGAGGGCAGG + Intergenic
921583591 1:216923766-216923788 CACTGGACAGCCAGGTGGTCAGG - Intronic
922232538 1:223699498-223699520 AAGAGGTGAGTGTGGTGGTCAGG - Intergenic
923441934 1:234028787-234028809 CAGAGGAAATTGAGGTGACCTGG - Intronic
924218226 1:241847485-241847507 AAGAGGACAGCGACGAGGTCTGG + Intergenic
924387300 1:243510699-243510721 AAGAGGTCAGAGAGGTGGACAGG + Intronic
1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG + Intronic
1064330179 10:14386361-14386383 CAGAGCACAGTGAGCTGGGCAGG - Intronic
1066538949 10:36423145-36423167 CAGATGGCAGTGTGGTGGCCTGG - Intergenic
1066782050 10:38961615-38961637 CAGAGGACAGTGAGGTGGCTAGG + Intergenic
1067734179 10:48836690-48836712 CAGGGGACTGTGATGGGGTCAGG - Intronic
1068313524 10:55310861-55310883 CTGAGGACTGTCAGGTGGTGAGG + Intronic
1069601589 10:69711441-69711463 CATAGCACACTGTGGTGGTCAGG + Intergenic
1069723029 10:70561641-70561663 CAGAGGCCAGTGAGGGTTTCTGG - Intronic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1069987230 10:72292698-72292720 CAGAGGACAGTGGGCTGCTCAGG - Intergenic
1070417745 10:76206210-76206232 CTGAGAACAGTGAGAGGGTCAGG - Intronic
1070799243 10:79235387-79235409 CAGAGCACACCGAGGTGCTCGGG + Intronic
1072518853 10:96212682-96212704 CAGAGGAAACTGATGTGGTGTGG + Intronic
1072760060 10:98049249-98049271 CAGAGGAGAGTCTGGTGGTCTGG + Intergenic
1073097496 10:100988653-100988675 TTGAGGACAGCGAGGAGGTCCGG + Exonic
1073191142 10:101651308-101651330 CAGAGGCCAGTGGGGTGGAGAGG + Intronic
1073348215 10:102800430-102800452 CAGAGGGCAAGGAGGTAGTCTGG + Intronic
1074899612 10:117804849-117804871 CAGAGGACAATCAGTTGATCAGG - Intergenic
1075070048 10:119314491-119314513 GAGAGGGAAGTGGGGTGGTCTGG - Intronic
1075566757 10:123510645-123510667 CAGAAGGGAGAGAGGTGGTCTGG - Intergenic
1076394167 10:130126501-130126523 CTGCGGAGAGTGAGGTGGGCCGG - Intergenic
1076491951 10:130867701-130867723 GAGAGGACACTGATGGGGTCAGG + Intergenic
1076762433 10:132612087-132612109 GAGAGGGAAGTGAGGTGGGCAGG + Intronic
1077011690 11:381640-381662 CCGGGGGCAGAGAGGTGGTCAGG - Intronic
1077498433 11:2897864-2897886 CAGAGGACAGAAGGGTGATCTGG - Intronic
1077571188 11:3339700-3339722 CAGAGGACACGGAGGTGGAGGGG + Intronic
1077860510 11:6174174-6174196 CAGAGGACAGTGGGGTAGTGAGG - Intergenic
1077921752 11:6646893-6646915 GAGAGGAAAGAGAGGTGGGCTGG + Intronic
1078142885 11:8704396-8704418 GAGAGCCCAGTGAGGTGGCCAGG + Intronic
1078339464 11:10488628-10488650 CAGAAGGCAGGGAGGTGGGCCGG + Intronic
1083909675 11:65698927-65698949 CATTGGCCAGTGAGGTGGTGGGG - Intergenic
1083925609 11:65804225-65804247 CAGAGGAGAGTGTGCTGGTTAGG - Intergenic
1084275907 11:68050838-68050860 CAGAGGTCAGGAAGGAGGTCTGG - Exonic
1084842782 11:71870217-71870239 CAAAGGACAGTGATATGGTTTGG - Intronic
1085047667 11:73362894-73362916 CAGAGGACAGTGGGACAGTCAGG + Intronic
1086939066 11:92776892-92776914 CAGGGGCTGGTGAGGTGGTCAGG - Intronic
1089103412 11:115982876-115982898 CAGTGGTCTGTGTGGTGGTCAGG - Intergenic
1090067952 11:123519307-123519329 GAGAGGACAGGGAAGTGGTGGGG + Intergenic
1090657362 11:128856280-128856302 CAGAGGAAATTCAGTTGGTCTGG - Intronic
1091037768 11:132248875-132248897 CATAGGAAAGGGTGGTGGTCAGG + Intronic
1091236748 11:134027110-134027132 GAGAGGCCAGGGAGGGGGTCTGG + Intergenic
1091391720 12:130043-130065 CAGAGGACAGTGGTGAGGACAGG + Intronic
1092097989 12:5860087-5860109 CAGATGACAGTGAGAAGGGCTGG - Intronic
1092204083 12:6605145-6605167 CAGTGGAAGTTGAGGTGGTCTGG - Intronic
1092218038 12:6695912-6695934 GAGAGGACATTGTGGTGGTGGGG - Intronic
1092534617 12:9376485-9376507 CAGAGCCCAGTGAGGTGGGCAGG - Intergenic
1093529769 12:20147083-20147105 CAGATGAGAGTGAGGAGGGCAGG + Intergenic
1094497409 12:30997086-30997108 CACAGTAGAGTGAGTTGGTCTGG - Intergenic
1094581641 12:31739092-31739114 CAGAGGTGGGTGTGGTGGTCTGG + Intergenic
1094608978 12:31974738-31974760 CAGGGGACAGTGAGGGGGACGGG + Intronic
1096741609 12:53697545-53697567 CTGAGCACAGTGGGGTGGTGGGG + Intergenic
1097017544 12:55998037-55998059 CAGAGAAGATTGAGGTGGTCCGG + Intronic
1098017304 12:66119425-66119447 CAGAGGACTGTCAGGTAGCCAGG - Exonic
1098205863 12:68109184-68109206 CAGATGACAGGGAGCTGGCCAGG - Intergenic
1100584983 12:95971171-95971193 TAGGGGACAGTGAGCTGCTCAGG + Intergenic
1101647484 12:106644869-106644891 CTGAGGACAGAGAGGAGGGCAGG + Intronic
1103596067 12:122024936-122024958 CAGGGGACAGTGGGTGGGTCGGG - Intronic
1103914285 12:124368518-124368540 GAGAGGTCAGAGAGGTGGGCAGG - Intronic
1103914333 12:124368725-124368747 CAGGGGAGAGTGGGCTGGTCAGG - Intronic
1104946238 12:132416050-132416072 CAGAGCTCAGTGAGGTGCCCTGG + Intergenic
1105265545 13:18810878-18810900 AAGGAGACAGTGAGGTGGCCTGG + Intergenic
1106218897 13:27728410-27728432 CAGAGGACAGTGTGCTTGTTAGG - Intergenic
1106233949 13:27845661-27845683 CAGAGGTCACTGAGGCGGTGGGG - Intergenic
1106355350 13:28976933-28976955 CAGAGGACAATTAGGTGGTTGGG + Intronic
1112808177 13:103186058-103186080 CATAGGACAGTGAGATTGCCTGG - Intergenic
1113582692 13:111440128-111440150 CAGAGGGCAGGGAGGTGGCAGGG + Intergenic
1113721608 13:112562020-112562042 CAGGAGACAGTGAGGCAGTCTGG + Intronic
1114277145 14:21156971-21156993 CAGAGGAGAGTGTGGTGTTTAGG - Intergenic
1116301967 14:43194637-43194659 CAGATGCCAGTGAGGTTGTGGGG + Intergenic
1116865963 14:50031891-50031913 CACAGGGCAGTGAGATGGCCAGG - Intergenic
1116965873 14:51014774-51014796 AAGACAACAGTGAGGTGGCCTGG - Intronic
1117962438 14:61176929-61176951 CAGAAGACAGTGAGTTGAACTGG - Intergenic
1118334426 14:64840814-64840836 CACAGGACAGAGAGGTGGATAGG + Intronic
1120034803 14:79684647-79684669 CAGAGGACAGGGAGGAGGTTTGG - Intronic
1120122033 14:80692788-80692810 CAGTGCAGAGTGAGCTGGTCTGG - Intronic
1120722227 14:87901659-87901681 GAGGAGACAGAGAGGTGGTCAGG - Intronic
1122127110 14:99585339-99585361 GAGAGCACAGAGAGGTGGTGTGG + Intronic
1122693889 14:103543665-103543687 CAGGGTACAGGGAGGTGGTGGGG - Intergenic
1122798766 14:104219560-104219582 CAGAGGACAGTGAGGGGCTGGGG - Intergenic
1122960823 14:105093004-105093026 CAGAGGAGAGGGGAGTGGTCAGG + Intergenic
1202938596 14_KI270725v1_random:118938-118960 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1123394605 15:19918954-19918976 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1124136547 15:27040396-27040418 CAGAGGAGAGTGAGTTGCTGGGG + Intronic
1124363896 15:29058184-29058206 CAGAGGACATTGCTTTGGTCTGG + Intronic
1124433859 15:29631859-29631881 CAGAGGCCAGGGAGGGGGTGTGG - Intergenic
1124600190 15:31127532-31127554 CCCAGGACAGGGAGGTGGTGAGG + Intronic
1124982825 15:34581210-34581232 CAGAGGACAGCGAGGAGTGCCGG + Intronic
1126106829 15:45152225-45152247 CAGAGGACAGAGAGCTGGTTAGG - Intronic
1126222901 15:46235475-46235497 CTGAGGATAGTGAGGTTGGCTGG - Intergenic
1127013826 15:54660510-54660532 CAGAGTACAATGAGGTGGCCTGG - Intergenic
1128367995 15:67018343-67018365 CAGGGGAAAGTCAGGTGGCCAGG - Intergenic
1128752213 15:70157843-70157865 CACAGGACAGTGGTGTGGTAAGG - Intergenic
1128941392 15:71790620-71790642 CTGAGGTCACTGAGGTGGGCCGG - Intergenic
1129679406 15:77649698-77649720 CAGAGGGCAGTTAGGGGCTCTGG + Intronic
1129885663 15:79035503-79035525 CAGAGGGCAGGGAGCTGCTCTGG + Intronic
1130416022 15:83695469-83695491 CCTAGGTCAGTGAGGTGGGCAGG - Intronic
1131879195 15:96844557-96844579 GAAGGGACAGTGAGGTGGTCAGG - Intergenic
1132582118 16:689669-689691 AGGAGGTCAGTGAGGTGGGCTGG + Exonic
1132739476 16:1404302-1404324 CTGTGCACAGTGAGGTGGGCGGG - Intronic
1133113813 16:3564767-3564789 CAGAGGCCAGTGGGGAGGTCTGG + Intronic
1133815951 16:9197493-9197515 CAGAGTACAGTGAGCAGGTCAGG + Intergenic
1135893931 16:26381415-26381437 CAGGGAACAGGAAGGTGGTCTGG - Intergenic
1136697209 16:32094045-32094067 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136700641 16:32137053-32137075 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136767017 16:32790412-32790434 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136797708 16:33037336-33037358 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136801132 16:33080289-33080311 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136863278 16:33715802-33715824 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1136936779 16:34475664-34475686 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136944955 16:34638273-34638295 CAGAGGACATTGAGGTGGCCAGG + Intergenic
1136947893 16:34677417-34677439 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136955284 16:34777301-34777323 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136959016 16:34823802-34823824 CAGAGGACAGTGAGGTGGCTAGG + Intergenic
1136963040 16:34872906-34872928 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136967137 16:34927110-34927132 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137085105 16:36110741-36110763 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1137087743 16:36149224-36149246 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137092190 16:36207381-36207403 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137221646 16:46458226-46458248 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1137609342 16:49808651-49808673 CAGAGGACAGTGGGAGGGGCGGG + Intronic
1138511093 16:57508798-57508820 CAGAGTAGAGTGTGGTGGTGAGG + Intergenic
1138603497 16:58072117-58072139 AAGAGGACAGTGATATGGTTTGG + Intergenic
1139367933 16:66445179-66445201 AAAAGCACAGTGAGGTGGCCGGG + Intronic
1140215467 16:73003798-73003820 CAGAACAGAGTGAGGGGGTCAGG + Intronic
1140935722 16:79667875-79667897 CAGAGGTCACTGAGTTGGGCAGG - Intergenic
1141331887 16:83118202-83118224 CAGAGGAGAGTGAGGTTCTGGGG - Intronic
1141584516 16:85024694-85024716 CTGAGGAAACTGAGGTGGTCTGG - Intergenic
1141871640 16:86790544-86790566 ATGAGGACAGTAATGTGGTCTGG + Intergenic
1142145475 16:88491210-88491232 CAGGGGACACTGAGGCAGTCAGG - Intronic
1203069412 16_KI270728v1_random:1052658-1052680 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1203124769 16_KI270728v1_random:1563953-1563975 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1143393682 17:6575608-6575630 TAGAGGACATGGAGGTGGACGGG + Intergenic
1143462438 17:7112580-7112602 CAGAGGAGAGTGAGGCGGACAGG + Intronic
1143881134 17:10030984-10031006 CAGAGGACAGTGATGGTGTTGGG - Intronic
1144493059 17:15731356-15731378 AAGGGGGCAGTGAGGTGGCCTGG - Intergenic
1144907196 17:18645297-18645319 AAGGGGGCAGTGAGGTGGCCTGG + Intronic
1145324122 17:21785029-21785051 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1145326486 17:21833769-21833791 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1145689474 17:26722935-26722957 CAGAGGACAGTGAGGTGGTCAGG + Intergenic
1145995099 17:29100424-29100446 AAGAAGCCAGTGAGGTGGGCGGG + Intronic
1146623455 17:34418423-34418445 CAGAGGAGAGTGCTGAGGTCTGG - Intergenic
1146919345 17:36699723-36699745 TAGGGGCCAGAGAGGTGGTCTGG - Intergenic
1147012733 17:37464542-37464564 TAAAAGACAGTGAGGTGGCCGGG + Intronic
1148327451 17:46791500-46791522 CAGAAAACAGTGAGGAGGCCGGG - Intronic
1148643724 17:49207004-49207026 CAGAGGACAGACAGGTGTTCGGG + Intronic
1148749501 17:49936397-49936419 CAGAGGGCAGTGAGGAGGCTGGG - Intergenic
1149598220 17:57876349-57876371 CAGAGGACAGGGAGGCGCTCAGG - Intronic
1149986283 17:61349531-61349553 CAGGGGGCAGTGAGGGGCTCTGG - Intronic
1152130589 17:78473941-78473963 CAGAGGACAGGGCTGTGTTCAGG + Intronic
1152255737 17:79238472-79238494 CAGGGGACACGGAGGTGTTCGGG - Intronic
1152699349 17:81811359-81811381 CAGAGGACAGGGAGGAGGACGGG + Intronic
1203182742 17_KI270729v1_random:78899-78921 CAGGGGACAGTGAGGTGGCCAGG + Intergenic
1203190677 17_KI270729v1_random:184395-184417 TAGAGGACAGTGAGGTGGCCAGG + Intergenic
1154422856 18:14250648-14250670 AAGGAGACAGTGAGGTGGCCTGG - Intergenic
1154516530 18:15173415-15173437 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1156447551 18:37248736-37248758 CAGAGGACTATGAAGTGGTGAGG - Intronic
1156926236 18:42583419-42583441 AAGAGGCAAGTCAGGTGGTCTGG + Intergenic
1157014870 18:43699826-43699848 CAGATGACAGTGATATGGACAGG - Intergenic
1157328823 18:46688667-46688689 CAGAGGACCGTGAGTGAGTCAGG + Intronic
1160012249 18:75115051-75115073 CTGAGGAGAGTGATGTGGTTTGG + Intergenic
1160390905 18:78531808-78531830 CAGAGGCCTGTGGGGTGATCGGG + Intergenic
1160429699 18:78803112-78803134 CAGAGGACCATGAGGTCGTCAGG - Intergenic
1161578445 19:5067574-5067596 CAGAGGACAGAGAGCTGGTGTGG + Intronic
1162038459 19:7955174-7955196 CTGAGGACACTGAGGTGGGAGGG + Intergenic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162519665 19:11172422-11172444 CTGAGGACAGTGAGGAGGAGAGG - Intronic
1162526931 19:11211633-11211655 CAGAGGCAAGTGAGGGGGACAGG - Intronic
1162965080 19:14151666-14151688 TAGGGGACAGTGAGGGGGTGCGG + Intronic
1163055815 19:14716788-14716810 CAGAGGACACTGAGGCTCTCCGG - Intronic
1163125000 19:15239839-15239861 CAGCGGCCGGTGAGGTGGGCAGG + Intronic
1164671026 19:30072023-30072045 CGGAGGACAGGGTGGAGGTCTGG + Intergenic
1165050584 19:33139115-33139137 CAGAGGACAGAAAGGTGTCCAGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165471712 19:36008161-36008183 CAGGGGACAGAGAGGAGGTGGGG + Intronic
1165728888 19:38131501-38131523 CAAAGGACAGAGAGGTGACCAGG + Intronic
1165860232 19:38905482-38905504 AAGAGGAGAGTGAGGAGGACTGG + Exonic
1166276916 19:41760557-41760579 TAGAAGACAGTGAGGGGGACAGG - Intronic
1166643420 19:44513263-44513285 CTGAGGACAGGGAGGAGGACTGG + Exonic
1167212186 19:48140063-48140085 TAGAGGACAGGGAGGAGGTCTGG + Exonic
1167268214 19:48493748-48493770 CAGAGGACAGCGAGCTGGAGAGG - Exonic
1167752254 19:51388138-51388160 CAGAGGTCAGTGAGTGGGTGGGG - Intergenic
1202668912 1_KI270709v1_random:30796-30818 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
925028053 2:625128-625150 CAGGGGGCAGTGAGGGGCTCTGG - Intergenic
926323235 2:11763371-11763393 GAGTGGACAGTGATGTGGGCAGG + Intronic
926656564 2:15413835-15413857 CAGAGAACAGTGATGTTGTTGGG - Intronic
930595266 2:53379850-53379872 CTGTGGACAGTGAGGGGGTCAGG - Intergenic
930938924 2:56989869-56989891 CACTGGGCAGTGAGATGGTCTGG + Intergenic
931387128 2:61808000-61808022 CAGAGAACAGTGTCCTGGTCTGG + Intergenic
931933648 2:67170151-67170173 GAGATGAGAGTGAGGTGGGCTGG - Intergenic
932199400 2:69812341-69812363 CACAGGAGAGTGGGGTGGTGGGG + Intronic
932446095 2:71782477-71782499 CAGAGGACAGTGGGGTGGGGAGG + Intergenic
934252377 2:90369071-90369093 CAGAGGACAGTGAGGTGGACAGG - Intergenic
934257064 2:91433874-91433896 CAGAGGACAGTGAGGTGGACAGG + Intergenic
934925989 2:98382089-98382111 CAGATGTCTGTGAGGTGGTCGGG - Intronic
935353655 2:102177968-102177990 GACAGGGCAGGGAGGTGGTCTGG - Exonic
937303993 2:120860060-120860082 CAGAGGTCATGGTGGTGGTCAGG + Intronic
937358036 2:121210776-121210798 CAGAGGACAGTGAGTTCGGATGG - Intergenic
937912420 2:127082005-127082027 CAGAGGACAGGCAGGCGGGCAGG + Intronic
938066959 2:128286487-128286509 CAGAGGACAGGCAGGAGGCCGGG + Intronic
938516852 2:132018409-132018431 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
938607060 2:132905782-132905804 AAGAGTGCAGTAAGGTGGTCAGG - Intronic
938842533 2:135176933-135176955 CAGAGGCCGGGGAGGTGGTGGGG + Intronic
939295768 2:140262722-140262744 TAGAGGAGAGTGAGGAGGTCAGG - Intronic
939633251 2:144550932-144550954 AAGAGGATAGTGAGGTGGAAGGG + Intergenic
941711834 2:168722882-168722904 CAGAGGACAGTGATATCATCAGG - Intronic
941939134 2:171014671-171014693 GTGAGGACAGTAAGGTGGCCAGG + Intronic
942314824 2:174688574-174688596 CAGTGCTCAGTGAGGTTGTCTGG + Intergenic
942795986 2:179819617-179819639 CAGAACACTGTGAGGTGCTCAGG + Intronic
942808572 2:179967422-179967444 CTGAGACCTGTGAGGTGGTCTGG + Intronic
943234515 2:185300570-185300592 CAGAGGACAAAGACGTGGGCTGG - Intergenic
943729410 2:191285961-191285983 CGGAGAACAGTGACTTGGTCAGG - Intronic
944879701 2:203999915-203999937 CAGAAGGCAGTTAGGTGCTCTGG + Intergenic
945096105 2:206221211-206221233 CAAAGGAAAGTGAGGTGGTTTGG + Intergenic
945442785 2:209900110-209900132 CATAAGACAGTGAGGCAGTCAGG - Intronic
946308435 2:218869559-218869581 CAGAGGACAGGGTGGGGGTAGGG - Intronic
946396385 2:219445674-219445696 GAGAAGAGAGTGAGGTGGCCAGG + Intronic
947223602 2:227819067-227819089 CAGAGGAAAGGGAGGTGGGGTGG + Intergenic
947430161 2:230021057-230021079 CAGAGAACAGTGAGTTGGGGAGG - Intergenic
947445686 2:230161010-230161032 CAAGGGACAGTGAGGAGGGCAGG - Intergenic
947827000 2:233113299-233113321 CTGGGGCCAGGGAGGTGGTCAGG - Intronic
947953723 2:234170072-234170094 CATGGGACACTGAGGTGTTCTGG + Intergenic
948672146 2:239575416-239575438 CCCAGGAGAGTGAGGTGGACAGG + Intergenic
1168804201 20:663132-663154 CAGAGGCCAGAGGGATGGTCTGG + Exonic
1169252145 20:4068980-4069002 CAGAGGACCGAAAGGTGGGCTGG + Intergenic
1169285713 20:4305555-4305577 CAGAGCACGGTGAGATGGTTCGG + Intergenic
1170884611 20:20329355-20329377 CACAGGACAGAGAGGTGAACAGG - Intronic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1171954937 20:31454492-31454514 CAGTAGACAGTGAGGTGTTCTGG + Intergenic
1172193672 20:33077550-33077572 CAGGAGGCAATGAGGTGGTCTGG + Intergenic
1173980526 20:47220423-47220445 CAGAGGACACTGAGATGCTTTGG - Intronic
1174389281 20:50207893-50207915 CATAGGAGAGTCAGGTGGGCAGG + Intergenic
1174721203 20:52814534-52814556 CAACAGACAGTGAGGTGGCCAGG + Intergenic
1176086128 20:63296423-63296445 CTGAGGACAGCCAGGTGGGCTGG + Intronic
1176584719 21:8570195-8570217 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1176850612 21:13909309-13909331 AAGGAGACAGTGAGGTGGCCTGG + Intergenic
1177348199 21:19900431-19900453 GAGCAGACAGTGAGGTAGTCAGG + Intergenic
1179385750 21:40940585-40940607 CAGAGGACTGTGAGGTTCTTTGG + Intergenic
1179727163 21:43347064-43347086 CAGACCACAGTGAGGGGGCCAGG + Intergenic
1179807752 21:43850785-43850807 CAGAGGACATTGGTTTGGTCTGG - Intergenic
1180267530 22:10547097-10547119 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1181235569 22:21445983-21446005 GAGAGGAGGGTGAGGGGGTCGGG + Exonic
1181745647 22:24953395-24953417 CGGAGGACAGCGCGGTGGTTCGG + Intronic
1182657901 22:31904293-31904315 GAGTGGACAGTCAGGTGGCCAGG + Intronic
1182824075 22:33247844-33247866 CAGATGCCCGTGAGCTGGTCTGG + Intronic
1183243194 22:36673588-36673610 GAGAGGACAAGGAGGAGGTCTGG + Intronic
1183641635 22:39096376-39096398 CAAAGGTCAGTGGGGTGGTGGGG + Intergenic
1183911326 22:41081678-41081700 CAGAAGACAGAGAGGTTGACTGG + Intergenic
1184694435 22:46131683-46131705 CAGAGGTCACCGAGGTTGTCCGG + Intergenic
1184755385 22:46512866-46512888 CAGAGGACAGCCAGGTGCTGTGG - Intronic
1185095424 22:48803704-48803726 CAGCGGCCAGTGTGCTGGTCAGG - Intronic
1185169066 22:49281778-49281800 CAGAGGACAGTGACTGGGCCAGG + Intergenic
1203325729 22_KI270738v1_random:14548-14570 CAGAGGACAGTGAGGTGGACAGG - Intergenic
949559607 3:5188883-5188905 CTGAGGATAGTTAGGTGGTGGGG + Intronic
950109655 3:10410823-10410845 CAGAGAACAGAGAGGTTGGCTGG + Intronic
950404087 3:12793887-12793909 ATGAGGACAGAGAGGTGGACAGG - Intergenic
950722306 3:14892020-14892042 AAGAGGACAGGGAGGTGGGATGG - Intronic
952338295 3:32423860-32423882 CAGAGGACAGTGACGGGCACAGG - Intronic
952407075 3:33014325-33014347 CAGAGCACAGTGAGCTGGGGAGG + Intronic
953104242 3:39860514-39860536 CAGAAGACAGGGAGGTCCTCAGG - Intronic
953800052 3:46015956-46015978 GAGAGGTCAGCAAGGTGGTCTGG + Intergenic
954197266 3:49004170-49004192 CAGAGTCCAGTGAGCTGGTGCGG + Exonic
954630488 3:52045268-52045290 CAGGGGACAGGGAGGAGGCCAGG - Intergenic
955317055 3:57947893-57947915 CAGAGGTCAGGGAGGTAGTGGGG + Intergenic
955826815 3:62956212-62956234 CAGAGGACACTGAATTGGTAAGG + Intergenic
956388643 3:68748047-68748069 GGGAGAACAGAGAGGTGGTCAGG - Intronic
956779032 3:72589890-72589912 CAGAGTACACTGAAGTGGTGAGG + Intergenic
957513462 3:81220560-81220582 CAGAGGACATAGAGGTCGTGTGG - Intergenic
958784119 3:98578081-98578103 CATAAGACAGTTAGGTGTTCAGG + Intronic
958887627 3:99745039-99745061 CAGAGGGCAGGGCAGTGGTCTGG + Intronic
960409447 3:117304757-117304779 CAGAGTACAGTGTGTTGGTTGGG + Intergenic
961212856 3:125139495-125139517 CAGGGGACCGTGAGGTGGGGTGG - Intronic
961404555 3:126668894-126668916 CAGAGGCCAGTGGGGAGCTCAGG + Intergenic
961754096 3:129116930-129116952 CTGAGGACACTGAGGTGGGGAGG + Intronic
962174296 3:133136734-133136756 CAGAGGAAAGGGAGCTGGTCAGG + Intronic
962237046 3:133715565-133715587 GAGAGGAAAGTGAGGTGGAGAGG - Intergenic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
964471819 3:157064636-157064658 TTGAGGACAGGGCGGTGGTCAGG + Intergenic
964987990 3:162768888-162768910 CAGTGGACAGTCAGGTAGACTGG + Intergenic
965332164 3:167389132-167389154 CTGAGGCCTGTCAGGTGGTCGGG - Intergenic
965615350 3:170586438-170586460 CAGAGGGCAGGAAGGAGGTCTGG - Intronic
967814983 3:193790842-193790864 TACAGGACAGAGAGGTGCTCCGG - Intergenic
967930700 3:194688147-194688169 CAAGGGACAGGGAGGTTGTCGGG - Exonic
968814571 4:2815253-2815275 CAGAGGATAGTAAGGTGGCAGGG + Intronic
968890567 4:3366510-3366532 TAGCTGAGAGTGAGGTGGTCCGG + Intronic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
969405357 4:6987773-6987795 TAGAGCCCAATGAGGTGGTCAGG + Intronic
969590390 4:8118648-8118670 CAGAGGGCAGTGAGGAAGTCAGG - Intronic
969783883 4:9436273-9436295 CAAAGGACAGTGATATGGTTTGG - Intergenic
969817896 4:9699628-9699650 CAGAGGACAGTGAGCAGGGTGGG + Intergenic
969871923 4:10110048-10110070 CAAAGAACAGAGAGGTGCTCAGG + Intronic
971047730 4:22824377-22824399 CAGAGGAGAGTGAGGTGGGTGGG + Intergenic
975941987 4:79659294-79659316 CAGAGGCCAGTGATATGGTTTGG + Intergenic
978137147 4:105276029-105276051 CAGAGGACAACGATGAGGTCTGG + Exonic
981008744 4:139902803-139902825 CAGAAGTCAGTGAGGTTGTGCGG - Intronic
982253463 4:153430581-153430603 CAGAGGATACTGGGGAGGTCAGG + Intergenic
982722137 4:158869837-158869859 CAGAGCAGCGTGAGGTGGTTGGG + Intronic
983131314 4:164022985-164023007 CAGAGGACAGAGGTGTGGCCTGG + Intronic
984051860 4:174874181-174874203 GAGAGGAAAGAGAGGTGGGCAGG - Intronic
984212503 4:176867737-176867759 TAGAGGAAAATGAGGTTGTCAGG - Intergenic
985005618 4:185532496-185532518 CAGAGGACAGTGGTGTGGTGTGG + Intronic
986840135 5:11687321-11687343 TTGAGGCCAGTGAGGTGGGCAGG - Intronic
987020324 5:13863837-13863859 CAGAGGCCAGGGAGGTGGAGTGG - Intronic
988168468 5:27624810-27624832 CAAAGGACAGTGAGGCTGTTCGG - Intergenic
988460178 5:31428264-31428286 AAGAGGACAGGGAGGAGGTGGGG + Intronic
988621729 5:32830083-32830105 CAGAGCACAGTGAGGTCTGCAGG - Intergenic
988870477 5:35384511-35384533 CAGAGGCCTGTGAGGTGAGCAGG - Intergenic
989576294 5:42991580-42991602 CCTAGGACAGAGAGGTGGTGTGG + Intergenic
990009923 5:50984800-50984822 CAAAGGTCAGTGAGGTGATTAGG - Intergenic
990908087 5:60824917-60824939 CAGAGGTCAGAGAGGTAGTCAGG - Intronic
991045856 5:62221911-62221933 CAGAGGAGAGTGAGGAAGTGTGG - Intergenic
992498966 5:77322720-77322742 CAGAGCAGAGTAAGGGGGTCAGG - Intronic
997285447 5:132674982-132675004 CAGAGGGCTGTTAGGTGGCCAGG - Intronic
997894579 5:137704706-137704728 CAGAGGACTGTGTGGTGCTCAGG - Intronic
999124331 5:149235865-149235887 CAGGAGACAGTGAGGTATTCAGG + Intronic
999624494 5:153506027-153506049 CAGAGGAGAATGAGGTGCCCTGG + Intronic
1001627079 5:173144845-173144867 CGGAGAACAGTGGGGTGCTCTGG - Intronic
1001732610 5:173971646-173971668 CAGAGGACAGGGAGGGGATTGGG - Intergenic
1001919852 5:175591184-175591206 CAGAGCACACTTAGGTGCTCAGG + Intergenic
1002712418 5:181203578-181203600 TGGAGGACTGTGAGGTGTTCCGG - Exonic
1003253894 6:4457647-4457669 CAGAGGGCAGAGTGGTGGGCAGG - Intergenic
1003391163 6:5714265-5714287 CAGGGGACAGTGGGCAGGTCTGG + Intronic
1003604285 6:7544793-7544815 CAAAGAACAGGCAGGTGGTCGGG - Intronic
1005490480 6:26343174-26343196 CAGGGGACAGGGAAGTGGTTAGG + Intergenic
1005844279 6:29765545-29765567 GTGAAGACAGTGAGGTGGTTGGG - Intergenic
1005856387 6:29866348-29866370 GTGAGGACAGTGAGGTGGTTGGG - Intergenic
1006511022 6:34521232-34521254 GAGAGGACAGGGAGGAGGTGGGG + Intronic
1006682623 6:35808057-35808079 CAGAGAACAGGGAGGTGGCAAGG - Intronic
1006718539 6:36135590-36135612 CAGAGGCCCGTGTGGTGATCTGG + Intronic
1006826052 6:36937237-36937259 GAGAGGACTATGAGGGGGTCAGG - Intergenic
1006865360 6:37205327-37205349 CAGAAGACACTGAGGAGGCCAGG + Intergenic
1007628080 6:43257769-43257791 GGGAGGACAGAGAGGTGATCCGG - Intronic
1007735752 6:43981356-43981378 GAGGGGACAGTGAGTTGGTTAGG + Intergenic
1008057192 6:46957060-46957082 TAGAAAACAGTGAGGTGGTGGGG + Intergenic
1008422503 6:51318223-51318245 CAGAGGACACTGAGGTTGGTTGG + Intergenic
1016322211 6:142858277-142858299 CAGAGTGAAGTGAGGGGGTCAGG - Intronic
1019205187 6:170355553-170355575 CTGGGGACTGTGAGGGGGTCGGG + Intronic
1019451437 7:1100706-1100728 GAGGGGACAGTGAGGGGCTCCGG - Intronic
1019578737 7:1749819-1749841 CATGGGACAGAGAGGTGGCCAGG + Intergenic
1019655685 7:2193698-2193720 CAGTGCACAGTGAGGTTTTCCGG - Intronic
1022552261 7:31252004-31252026 CAGAGGAGAGTCAGGAGGCCTGG + Intergenic
1022781472 7:33588873-33588895 AAGAGGACAGTGAGGTGGTGTGG + Intronic
1023969379 7:44979711-44979733 CAGAGGACAGTTAGGGGCACAGG - Intergenic
1024807265 7:53157848-53157870 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025039093 7:55624105-55624127 CGGAGTACAGTGGTGTGGTCTGG + Intergenic
1025305931 7:57855324-57855346 CAGAGGAGAGTGAGGTGGCCAGG - Intergenic
1025319425 7:58078347-58078369 CAGAGAACAGTGAGGTGGCCAGG + Intergenic
1025477842 7:60948817-60948839 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025483263 7:61013082-61013104 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025489245 7:61091705-61091727 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025554288 7:62285128-62285150 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025560493 7:62368146-62368168 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025610648 7:63073223-63073245 CAGAGGGCAGTGATGTGCCCAGG + Intergenic
1026255658 7:68709031-68709053 CAGAGGAGAGTGTGGTGGTAAGG + Intergenic
1027187402 7:75980577-75980599 CTGAGGACAGGGTGGGGGTCTGG - Intronic
1027950636 7:84810398-84810420 CCAAGGACAGTGAGATGGGCAGG - Intergenic
1028675762 7:93458708-93458730 CCGAAGACAGAGAGGTGGTGTGG - Intronic
1030015170 7:105211949-105211971 CAGAACTCAGTGAGGTGATCAGG - Intronic
1034321791 7:150191073-150191095 CAAAGGATAGTGATATGGTCTGG - Intergenic
1034427239 7:151020461-151020483 CAGAGGAGAGGGAGGAGGCCGGG - Intronic
1034834512 7:154339281-154339303 CAGAGGACAGGGACGTGGGGTGG + Intronic
1036777512 8:11623765-11623787 CAGAGGACAGTTAGGAGGATAGG - Intergenic
1037747307 8:21656767-21656789 CAGAGAACAGTGATATGGTTTGG + Intergenic
1038123130 8:24641074-24641096 TGGTGGACAGTGAGGTGGCCAGG + Intergenic
1038324658 8:26563643-26563665 CAGAGGATAGAGAGGTGGAAAGG - Intronic
1039466792 8:37790240-37790262 CAGGAGACAGTGAGGAGGCCAGG - Intronic
1039906371 8:41789469-41789491 CAGAGCACAGTTTGGAGGTCAGG + Intronic
1039946589 8:42134673-42134695 CAGAGTACAGTGGCGTGATCTGG + Intergenic
1040101487 8:43511024-43511046 AAGGAGACAGTGAGGTGGCCTGG - Intergenic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1041077206 8:54179630-54179652 CAGAGGAGGCTGAGTTGGTCAGG - Intergenic
1041251814 8:55941513-55941535 AAGAGGAAAAGGAGGTGGTCAGG - Intronic
1042440312 8:68818434-68818456 CAAAGGATTGTGGGGTGGTCAGG + Exonic
1044539106 8:93390340-93390362 AAGAGGTCAGTGAGATGGTGGGG - Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1045812437 8:106238524-106238546 CAGAGATCAGGGAGATGGTCAGG + Intergenic
1046389671 8:113553755-113553777 CAGAGGAGATTGAGGTGGGAGGG + Intergenic
1046837529 8:118819566-118819588 CAGATGTCAGTGAGATTGTCAGG + Intergenic
1049090793 8:140511970-140511992 GGGAGGACAGTGGGGTGGGCGGG - Intronic
1049749469 8:144276497-144276519 CAGAGGACAGGGCCGTGGGCAGG - Intronic
1049792462 8:144478268-144478290 CAGAGGAGAGGGAGGAGGCCGGG + Intronic
1050587583 9:7129009-7129031 GAGAGGAGAGTGAGTTAGTCTGG + Intergenic
1052207348 9:25858418-25858440 CAGAGAATAATGAGGTGGTGTGG - Intergenic
1053080952 9:35176180-35176202 CAGCTGATAGTGAGGTGGTGGGG + Intronic
1053131027 9:35615844-35615866 CAGGGGCCTGTGAGGTGTTCAGG - Intronic
1055179093 9:73360868-73360890 CAGAGCACAGCTGGGTGGTCAGG - Intergenic
1055531105 9:77184882-77184904 CAGAGCAAAGTAAGGTGGTGGGG - Intronic
1055837108 9:80456404-80456426 CAGAGGACAGTGAGGTTAACAGG + Intergenic
1056295351 9:85187761-85187783 AAGACATCAGTGAGGTGGTCAGG - Intergenic
1057023830 9:91721228-91721250 GGGAGGACAGTGATGGGGTCAGG + Intronic
1057421353 9:94915572-94915594 TAGTTGACAGTGTGGTGGTCTGG + Intronic
1057678711 9:97155339-97155361 AAGGAGACAGTGAGGTGGCCTGG + Intergenic
1057949288 9:99356905-99356927 CAGAGGAGAGGGAGGTGGGAGGG + Intergenic
1058705754 9:107637013-107637035 GAGAGGCCACTGAGGTGGTAGGG + Intergenic
1058916181 9:109568261-109568283 CAGAGCCCAGTGGGGTGGTGTGG + Intergenic
1061017639 9:127991201-127991223 AAGAGGACAGGGAGGTGACCCGG - Intergenic
1061080491 9:128366805-128366827 CAGGGGACACTGAGGTGGGTTGG + Intergenic
1061489637 9:130938080-130938102 CAGAGGAGATTCAGGGGGTCAGG + Intronic
1062497720 9:136839508-136839530 CAGAGGTCAGCCAGGTGGCCAGG + Intronic
1062689896 9:137836190-137836212 CAGGGGACAGAGAGCTGGGCCGG - Intronic
1203614624 Un_KI270749v1:47717-47739 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1186528301 X:10269796-10269818 CCAAGGACAGAGACGTGGTCAGG - Intergenic
1190338017 X:49274560-49274582 CCGAGGACACTGGGGTGGACAGG - Intronic
1190427367 X:50345818-50345840 CAGAGAAAAGTGATGTGCTCAGG - Intronic
1192148878 X:68699633-68699655 CAGAGGACAGTGATGAGGCTGGG - Intronic
1192582627 X:72297861-72297883 CAGAGGACCGAGAGGAGGTAGGG - Intronic
1192910241 X:75596408-75596430 CACAGAACAGTCAGGTGGTGAGG - Intergenic