ID: 1145694003

View in Genome Browser
Species Human (GRCh38)
Location 17:26773686-26773708
Sequence CGGCAAAAAGCCGTGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694003_1145694009 5 Left 1145694003 17:26773686-26773708 CCCGCCGCCACGGCTTTTTGCCG No data
Right 1145694009 17:26773714-26773736 GCGATTTGCTCCCGCCGACGCGG No data
1145694003_1145694013 27 Left 1145694003 17:26773686-26773708 CCCGCCGCCACGGCTTTTTGCCG No data
Right 1145694013 17:26773736-26773758 GCTTTTTGCCCCCGCCACCGCGG No data
1145694003_1145694014 28 Left 1145694003 17:26773686-26773708 CCCGCCGCCACGGCTTTTTGCCG No data
Right 1145694014 17:26773737-26773759 CTTTTTGCCCCCGCCACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694003 Original CRISPR CGGCAAAAAGCCGTGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr