ID: 1145694521

View in Genome Browser
Species Human (GRCh38)
Location 17:26775728-26775750
Sequence CCCTCAGTGCCGCGGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694521_1145694533 19 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694533 17:26775770-26775792 CGCCAGCTCCACTGGCGTCCTGG No data
1145694521_1145694530 -5 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694521_1145694535 24 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694535 17:26775775-26775797 GCTCCACTGGCGTCCTGGCAAGG No data
1145694521_1145694531 11 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694521_1145694536 25 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694536 17:26775776-26775798 CTCCACTGGCGTCCTGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694521 Original CRISPR CCCTCAGTGCCGCGGCGGCG GGG (reversed) Intergenic