ID: 1145694524

View in Genome Browser
Species Human (GRCh38)
Location 17:26775730-26775752
Sequence CGCCCTCAGTGCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694524_1145694531 9 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694524_1145694530 -7 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694524_1145694535 22 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694535 17:26775775-26775797 GCTCCACTGGCGTCCTGGCAAGG No data
1145694524_1145694536 23 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694536 17:26775776-26775798 CTCCACTGGCGTCCTGGCAAGGG No data
1145694524_1145694533 17 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694533 17:26775770-26775792 CGCCAGCTCCACTGGCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694524 Original CRISPR CGCCCTCAGTGCCGCGGCGG CGG (reversed) Intergenic