ID: 1145694528

View in Genome Browser
Species Human (GRCh38)
Location 17:26775736-26775758
Sequence CGCTCCCGCCCTCAGTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694528_1145694533 11 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694533 17:26775770-26775792 CGCCAGCTCCACTGGCGTCCTGG No data
1145694528_1145694535 16 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694535 17:26775775-26775797 GCTCCACTGGCGTCCTGGCAAGG No data
1145694528_1145694540 29 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694540 17:26775788-26775810 CCTGGCAAGGGCAGCGCCGAGGG No data
1145694528_1145694541 30 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694541 17:26775789-26775811 CTGGCAAGGGCAGCGCCGAGGGG No data
1145694528_1145694536 17 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694536 17:26775776-26775798 CTCCACTGGCGTCCTGGCAAGGG No data
1145694528_1145694538 28 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694538 17:26775787-26775809 TCCTGGCAAGGGCAGCGCCGAGG No data
1145694528_1145694531 3 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694528 Original CRISPR CGCTCCCGCCCTCAGTGCCG CGG (reversed) Intergenic