ID: 1145694530

View in Genome Browser
Species Human (GRCh38)
Location 17:26775746-26775768
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694517_1145694530 9 Left 1145694517 17:26775714-26775736 CCGAGGATTTTTACCCCCGCCGC No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694523_1145694530 -6 Left 1145694523 17:26775729-26775751 CCCGCCGCCGCGGCACTGAGGGC No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694515_1145694530 16 Left 1145694515 17:26775707-26775729 CCCGCTGCCGAGGATTTTTACCC No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694524_1145694530 -7 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694514_1145694530 17 Left 1145694514 17:26775706-26775728 CCCCGCTGCCGAGGATTTTTACC No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694527_1145694530 -10 Left 1145694527 17:26775733-26775755 CCGCCGCGGCACTGAGGGCGGGA No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694521_1145694530 -5 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694519_1145694530 -4 Left 1145694519 17:26775727-26775749 CCCCCGCCGCCGCGGCACTGAGG No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data
1145694516_1145694530 15 Left 1145694516 17:26775708-26775730 CCGCTGCCGAGGATTTTTACCCC No data
Right 1145694530 17:26775746-26775768 GAGGGCGGGAGCGGCAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694530 Original CRISPR GAGGGCGGGAGCGGCAGACT CGG Intergenic