ID: 1145694531

View in Genome Browser
Species Human (GRCh38)
Location 17:26775762-26775784
Sequence GACTCGGCCGCCAGCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694517_1145694531 25 Left 1145694517 17:26775714-26775736 CCGAGGATTTTTACCCCCGCCGC No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694528_1145694531 3 Left 1145694528 17:26775736-26775758 CCGCGGCACTGAGGGCGGGAGCG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694524_1145694531 9 Left 1145694524 17:26775730-26775752 CCGCCGCCGCGGCACTGAGGGCG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694521_1145694531 11 Left 1145694521 17:26775728-26775750 CCCCGCCGCCGCGGCACTGAGGG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694527_1145694531 6 Left 1145694527 17:26775733-26775755 CCGCCGCGGCACTGAGGGCGGGA No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694519_1145694531 12 Left 1145694519 17:26775727-26775749 CCCCCGCCGCCGCGGCACTGAGG No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data
1145694523_1145694531 10 Left 1145694523 17:26775729-26775751 CCCGCCGCCGCGGCACTGAGGGC No data
Right 1145694531 17:26775762-26775784 GACTCGGCCGCCAGCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694531 Original CRISPR GACTCGGCCGCCAGCTCCAC TGG Intergenic