ID: 1145694651

View in Genome Browser
Species Human (GRCh38)
Location 17:26777293-26777315
Sequence ACTACCTTAATAGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145694651_1145694653 7 Left 1145694651 17:26777293-26777315 CCCACTGGGGCTATTAAGGTAGT No data
Right 1145694653 17:26777323-26777345 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145694651 Original CRISPR ACTACCTTAATAGCCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr