ID: 1145694653 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:26777323-26777345 |
Sequence | TATTATCTTTAGAAGTTTTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145694651_1145694653 | 7 | Left | 1145694651 | 17:26777293-26777315 | CCCACTGGGGCTATTAAGGTAGT | No data | ||
Right | 1145694653 | 17:26777323-26777345 | TATTATCTTTAGAAGTTTTATGG | No data | ||||
1145694652_1145694653 | 6 | Left | 1145694652 | 17:26777294-26777316 | CCACTGGGGCTATTAAGGTAGTT | No data | ||
Right | 1145694653 | 17:26777323-26777345 | TATTATCTTTAGAAGTTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145694653 | Original CRISPR | TATTATCTTTAGAAGTTTTA TGG | Intergenic | ||
No off target data available for this crispr |