ID: 1145713148

View in Genome Browser
Species Human (GRCh38)
Location 17:26994655-26994677
Sequence CTCACTCACCACAGTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145713142_1145713148 -9 Left 1145713142 17:26994641-26994663 CCACATTCTTCCTCCTCACTCAC No data
Right 1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG No data
1145713138_1145713148 23 Left 1145713138 17:26994609-26994631 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG No data
1145713139_1145713148 17 Left 1145713139 17:26994615-26994637 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG No data
1145713141_1145713148 4 Left 1145713141 17:26994628-26994650 CCATCTCTCAATTCCACATTCTT No data
Right 1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG No data
1145713140_1145713148 13 Left 1145713140 17:26994619-26994641 CCTCATCTTCCATCTCTCAATTC No data
Right 1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145713148 Original CRISPR CTCACTCACCACAGTCATGG GGG Intergenic