ID: 1145713684

View in Genome Browser
Species Human (GRCh38)
Location 17:26999017-26999039
Sequence GGAATAAAGATTCCCCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145713684_1145713686 2 Left 1145713684 17:26999017-26999039 CCAGAATGGGGAATCTTTATTCC No data
Right 1145713686 17:26999042-26999064 TTTCTGCCCAAGATCATTCCTGG No data
1145713684_1145713687 3 Left 1145713684 17:26999017-26999039 CCAGAATGGGGAATCTTTATTCC No data
Right 1145713687 17:26999043-26999065 TTCTGCCCAAGATCATTCCTGGG No data
1145713684_1145713691 22 Left 1145713684 17:26999017-26999039 CCAGAATGGGGAATCTTTATTCC No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145713684 Original CRISPR GGAATAAAGATTCCCCATTC TGG (reversed) Intergenic
No off target data available for this crispr