ID: 1145713685

View in Genome Browser
Species Human (GRCh38)
Location 17:26999038-26999060
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145713685_1145713691 1 Left 1145713685 17:26999038-26999060 CCTGTTTCTGCCCAAGATCATTC No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145713685 Original CRISPR GAATGATCTTGGGCAGAAAC AGG (reversed) Intergenic
No off target data available for this crispr