ID: 1145713688

View in Genome Browser
Species Human (GRCh38)
Location 17:26999048-26999070
Sequence AACTACCCAGGAATGATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145713688_1145713691 -9 Left 1145713688 17:26999048-26999070 CCCAAGATCATTCCTGGGTAGTT No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145713688 Original CRISPR AACTACCCAGGAATGATCTT GGG (reversed) Intergenic
No off target data available for this crispr