ID: 1145713691

View in Genome Browser
Species Human (GRCh38)
Location 17:26999062-26999084
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145713684_1145713691 22 Left 1145713684 17:26999017-26999039 CCAGAATGGGGAATCTTTATTCC No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data
1145713688_1145713691 -9 Left 1145713688 17:26999048-26999070 CCCAAGATCATTCCTGGGTAGTT No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data
1145713685_1145713691 1 Left 1145713685 17:26999038-26999060 CCTGTTTCTGCCCAAGATCATTC No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data
1145713689_1145713691 -10 Left 1145713689 17:26999049-26999071 CCAAGATCATTCCTGGGTAGTTC No data
Right 1145713691 17:26999062-26999084 TGGGTAGTTCTACTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145713691 Original CRISPR TGGGTAGTTCTACTATAGTT TGG Intergenic