ID: 1145722019

View in Genome Browser
Species Human (GRCh38)
Location 17:27082549-27082571
Sequence GACATTTCCCCTGGTCGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722019_1145722031 22 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722031 17:27082594-27082616 TTGCAGCCTATTCCATGAGGGGG No data
1145722019_1145722028 19 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722019_1145722022 -2 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722022 17:27082570-27082592 TCCTTCTACCTGCCCTCTGCTGG No data
1145722019_1145722033 28 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722033 17:27082600-27082622 CCTATTCCATGAGGGGGCACTGG No data
1145722019_1145722029 20 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722029 17:27082592-27082614 GGTTGCAGCCTATTCCATGAGGG No data
1145722019_1145722024 -1 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722024 17:27082571-27082593 CCTTCTACCTGCCCTCTGCTGGG No data
1145722019_1145722030 21 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722030 17:27082593-27082615 GTTGCAGCCTATTCCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145722019 Original CRISPR GACATTTCCCCTGGTCGGAA AGG (reversed) Intergenic
No off target data available for this crispr