ID: 1145722020

View in Genome Browser
Species Human (GRCh38)
Location 17:27082554-27082576
Sequence AGAAGGACATTTCCCCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722020_1145722029 15 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722029 17:27082592-27082614 GGTTGCAGCCTATTCCATGAGGG No data
1145722020_1145722024 -6 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722024 17:27082571-27082593 CCTTCTACCTGCCCTCTGCTGGG No data
1145722020_1145722033 23 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722033 17:27082600-27082622 CCTATTCCATGAGGGGGCACTGG No data
1145722020_1145722031 17 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722031 17:27082594-27082616 TTGCAGCCTATTCCATGAGGGGG No data
1145722020_1145722028 14 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722020_1145722030 16 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722030 17:27082593-27082615 GTTGCAGCCTATTCCATGAGGGG No data
1145722020_1145722035 30 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722035 17:27082607-27082629 CATGAGGGGGCACTGGAAGCAGG No data
1145722020_1145722022 -7 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722022 17:27082570-27082592 TCCTTCTACCTGCCCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145722020 Original CRISPR AGAAGGACATTTCCCCTGGT CGG (reversed) Intergenic
No off target data available for this crispr