ID: 1145722021

View in Genome Browser
Species Human (GRCh38)
Location 17:27082558-27082580
Sequence AGGTAGAAGGACATTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722021_1145722028 10 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722021_1145722033 19 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722033 17:27082600-27082622 CCTATTCCATGAGGGGGCACTGG No data
1145722021_1145722035 26 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722035 17:27082607-27082629 CATGAGGGGGCACTGGAAGCAGG No data
1145722021_1145722029 11 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722029 17:27082592-27082614 GGTTGCAGCCTATTCCATGAGGG No data
1145722021_1145722030 12 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722030 17:27082593-27082615 GTTGCAGCCTATTCCATGAGGGG No data
1145722021_1145722024 -10 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722024 17:27082571-27082593 CCTTCTACCTGCCCTCTGCTGGG No data
1145722021_1145722037 30 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722037 17:27082611-27082633 AGGGGGCACTGGAAGCAGGAGGG No data
1145722021_1145722031 13 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722031 17:27082594-27082616 TTGCAGCCTATTCCATGAGGGGG No data
1145722021_1145722036 29 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722036 17:27082610-27082632 GAGGGGGCACTGGAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145722021 Original CRISPR AGGTAGAAGGACATTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr