ID: 1145722025

View in Genome Browser
Species Human (GRCh38)
Location 17:27082578-27082600
Sequence GCTGCAACCCAGCAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722025_1145722028 -10 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722025_1145722033 -1 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722033 17:27082600-27082622 CCTATTCCATGAGGGGGCACTGG No data
1145722025_1145722037 10 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722037 17:27082611-27082633 AGGGGGCACTGGAAGCAGGAGGG No data
1145722025_1145722038 18 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722038 17:27082619-27082641 CTGGAAGCAGGAGGGAGTTCTGG No data
1145722025_1145722040 24 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722040 17:27082625-27082647 GCAGGAGGGAGTTCTGGCTAGGG No data
1145722025_1145722031 -7 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722031 17:27082594-27082616 TTGCAGCCTATTCCATGAGGGGG No data
1145722025_1145722039 23 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722039 17:27082624-27082646 AGCAGGAGGGAGTTCTGGCTAGG No data
1145722025_1145722035 6 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722035 17:27082607-27082629 CATGAGGGGGCACTGGAAGCAGG No data
1145722025_1145722029 -9 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722029 17:27082592-27082614 GGTTGCAGCCTATTCCATGAGGG No data
1145722025_1145722030 -8 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722030 17:27082593-27082615 GTTGCAGCCTATTCCATGAGGGG No data
1145722025_1145722036 9 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722036 17:27082610-27082632 GAGGGGGCACTGGAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145722025 Original CRISPR GCTGCAACCCAGCAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr