ID: 1145722028

View in Genome Browser
Species Human (GRCh38)
Location 17:27082591-27082613
Sequence GGGTTGCAGCCTATTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722018_1145722028 23 Left 1145722018 17:27082545-27082567 CCAACCTTTCCGACCAGGGGAAA No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722019_1145722028 19 Left 1145722019 17:27082549-27082571 CCTTTCCGACCAGGGGAAATGTC No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722020_1145722028 14 Left 1145722020 17:27082554-27082576 CCGACCAGGGGAAATGTCCTTCT No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722021_1145722028 10 Left 1145722021 17:27082558-27082580 CCAGGGGAAATGTCCTTCTACCT No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722025_1145722028 -10 Left 1145722025 17:27082578-27082600 CCTGCCCTCTGCTGGGTTGCAGC No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data
1145722023_1145722028 -3 Left 1145722023 17:27082571-27082593 CCTTCTACCTGCCCTCTGCTGGG No data
Right 1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145722028 Original CRISPR GGGTTGCAGCCTATTCCATG AGG Intergenic
No off target data available for this crispr