ID: 1145723002

View in Genome Browser
Species Human (GRCh38)
Location 17:27090191-27090213
Sequence TCTACAATGCTGGCAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145722993_1145723002 13 Left 1145722993 17:27090155-27090177 CCACAGCAGGGGGTGGGTTGGGT No data
Right 1145723002 17:27090191-27090213 TCTACAATGCTGGCAGTGGGGGG No data
1145722991_1145723002 14 Left 1145722991 17:27090154-27090176 CCCACAGCAGGGGGTGGGTTGGG No data
Right 1145723002 17:27090191-27090213 TCTACAATGCTGGCAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145723002 Original CRISPR TCTACAATGCTGGCAGTGGG GGG Intergenic
No off target data available for this crispr