ID: 1145723168

View in Genome Browser
Species Human (GRCh38)
Location 17:27090896-27090918
Sequence TCCAGCTGGCCAGGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145723168_1145723178 24 Left 1145723168 17:27090896-27090918 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data
1145723168_1145723176 5 Left 1145723168 17:27090896-27090918 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145723168 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr