ID: 1145723176

View in Genome Browser
Species Human (GRCh38)
Location 17:27090924-27090946
Sequence CCAGGGGCCAGTTTCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145723166_1145723176 6 Left 1145723166 17:27090895-27090917 CCCAGCAATTCCTGGCCAGCTGG No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
1145723162_1145723176 30 Left 1145723162 17:27090871-27090893 CCCGAGAAGGGCAGGCTTGGTGG No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
1145723174_1145723176 -9 Left 1145723174 17:27090910-27090932 CCAGCTGGACTTGGCCAGGGGCC No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
1145723168_1145723176 5 Left 1145723168 17:27090896-27090918 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
1145723170_1145723176 -4 Left 1145723170 17:27090905-27090927 CCTGGCCAGCTGGACTTGGCCAG No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
1145723164_1145723176 29 Left 1145723164 17:27090872-27090894 CCGAGAAGGGCAGGCTTGGTGGA No data
Right 1145723176 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145723176 Original CRISPR CCAGGGGCCAGTTTCAGTGA AGG Intergenic
No off target data available for this crispr