ID: 1145723178

View in Genome Browser
Species Human (GRCh38)
Location 17:27090943-27090965
Sequence AAGGCATTCACTCTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145723168_1145723178 24 Left 1145723168 17:27090896-27090918 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data
1145723175_1145723178 -4 Left 1145723175 17:27090924-27090946 CCAGGGGCCAGTTTCAGTGAAGG No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data
1145723166_1145723178 25 Left 1145723166 17:27090895-27090917 CCCAGCAATTCCTGGCCAGCTGG No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data
1145723174_1145723178 10 Left 1145723174 17:27090910-27090932 CCAGCTGGACTTGGCCAGGGGCC No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data
1145723170_1145723178 15 Left 1145723170 17:27090905-27090927 CCTGGCCAGCTGGACTTGGCCAG No data
Right 1145723178 17:27090943-27090965 AAGGCATTCACTCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145723178 Original CRISPR AAGGCATTCACTCTCTCCCC AGG Intergenic
No off target data available for this crispr