ID: 1145725397

View in Genome Browser
Species Human (GRCh38)
Location 17:27116492-27116514
Sequence GCCTTCTAGCAAATACAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145725393_1145725397 7 Left 1145725393 17:27116462-27116484 CCATACTTATGGGGGATAATTGG No data
Right 1145725397 17:27116492-27116514 GCCTTCTAGCAAATACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145725397 Original CRISPR GCCTTCTAGCAAATACAATA AGG Intergenic
No off target data available for this crispr