ID: 1145728215

View in Genome Browser
Species Human (GRCh38)
Location 17:27153419-27153441
Sequence CATCTTCTCTGGGGGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145728215_1145728222 10 Left 1145728215 17:27153419-27153441 CCATGGATCCCCCAGAGAAGATG No data
Right 1145728222 17:27153452-27153474 GTGCCGACGCACGTTCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145728215 Original CRISPR CATCTTCTCTGGGGGATCCA TGG (reversed) Intergenic
No off target data available for this crispr