ID: 1145737559

View in Genome Browser
Species Human (GRCh38)
Location 17:27243696-27243718
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145737559_1145737566 -3 Left 1145737559 17:27243696-27243718 CCACCCACCTGCCATAAGTAAAA No data
Right 1145737566 17:27243716-27243738 AAAGGGACACCTTTCATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145737559 Original CRISPR TTTTACTTATGGCAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr