ID: 1145741265

View in Genome Browser
Species Human (GRCh38)
Location 17:27276702-27276724
Sequence ACATATCCACAGGGGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145741265_1145741274 -7 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741274 17:27276718-27276740 GATATGTTTCTGGTTAGGGTGGG No data
1145741265_1145741277 24 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741277 17:27276749-27276771 GACATTCTCATGCAGATTTGAGG No data
1145741265_1145741279 28 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741279 17:27276753-27276775 TTCTCATGCAGATTTGAGGGCGG No data
1145741265_1145741275 0 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741275 17:27276725-27276747 TTCTGGTTAGGGTGGGCCACAGG No data
1145741265_1145741273 -8 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741273 17:27276717-27276739 GGATATGTTTCTGGTTAGGGTGG No data
1145741265_1145741278 25 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741278 17:27276750-27276772 ACATTCTCATGCAGATTTGAGGG No data
1145741265_1145741280 29 Left 1145741265 17:27276702-27276724 CCCAGCATCCCCTGTGGATATGT No data
Right 1145741280 17:27276754-27276776 TCTCATGCAGATTTGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145741265 Original CRISPR ACATATCCACAGGGGATGCT GGG (reversed) Intergenic
No off target data available for this crispr