ID: 1145741837

View in Genome Browser
Species Human (GRCh38)
Location 17:27281298-27281320
Sequence AGCCAGGTATAGAGCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145741837_1145741841 -2 Left 1145741837 17:27281298-27281320 CCAACAGGGCTCTATACCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1145741841 17:27281319-27281341 CTGAGGGCACTGCCAGCTTCTGG 0: 1
1: 0
2: 2
3: 26
4: 282
1145741837_1145741843 10 Left 1145741837 17:27281298-27281320 CCAACAGGGCTCTATACCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1145741843 17:27281331-27281353 CCAGCTTCTGGACTGTGAAAAGG 0: 1
1: 0
2: 3
3: 16
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145741837 Original CRISPR AGCCAGGTATAGAGCCCTGT TGG (reversed) Intergenic
903565599 1:24263003-24263025 AGCCAGGTTTAGTGCCCTCCCGG + Intergenic
905421314 1:37847217-37847239 AATCAGGTATTGAGACCTGTTGG - Intronic
906241967 1:44247813-44247835 ACCTATGTAGAGAGCCCTGTTGG + Intronic
907481531 1:54748450-54748472 AGCCAGGTGAAGGGCCCTGGGGG + Intergenic
908321525 1:62983394-62983416 TGTCAGGTAGAGAGCCTTGTGGG + Intergenic
911465275 1:98244099-98244121 AGCCAGGTAAAGAGCTCTTTAGG + Intergenic
914961590 1:152214029-152214051 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914961713 1:152214737-152214759 GGCCAGATCCAGAGCCCTGTTGG + Exonic
914961838 1:152215439-152215461 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914961962 1:152216147-152216169 GGCCAGATCCAGAGCCCTGTTGG + Exonic
914962085 1:152216849-152216871 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914962335 1:152218259-152218281 GGCCAGATCCAGAGCCCTGTCGG + Exonic
914962577 1:152219657-152219679 GGCCAGATCCAGAGCCCTGTTGG + Exonic
915944792 1:160141760-160141782 AGCCAGGGATAGAGTCCTGCAGG - Exonic
916963722 1:169913946-169913968 TACCAGGTCTGGAGCCCTGTTGG + Intergenic
917520081 1:175740998-175741020 AGCCAGGTAAAGAGCTCTCTGGG - Intronic
919422271 1:197384607-197384629 AGGAAGCTATAGAGACCTGTGGG - Intronic
919796911 1:201326411-201326433 AGCCAGGTACAGAGTCCTCTAGG + Intronic
920163759 1:204020323-204020345 AGCCATGTGAAGAGCCATGTTGG + Intergenic
920224339 1:204427265-204427287 AGCCAGGTAATGAGCCCCTTGGG + Intronic
920518546 1:206604799-206604821 AGCCAAGTATTGTGGCCTGTTGG - Intronic
920837988 1:209529702-209529724 AGCCAGGCAGAGAGTCCTGGTGG + Intergenic
921819182 1:219596862-219596884 AGCAAGGAATCGAGCTCTGTCGG + Intergenic
922755324 1:228093393-228093415 TGCCAGGTATAGGGTCCTGTGGG + Intronic
1063594833 10:7424779-7424801 AGCAGGGTATAGGGCCCTGGGGG - Intergenic
1070422768 10:76253245-76253267 AGGCAAGGATAGAGTCCTGTGGG + Intronic
1072236894 10:93461326-93461348 TGCCAGGCATTGAGCACTGTAGG + Intronic
1074556937 10:114500071-114500093 AGACTTGTATAGAGCCCTCTAGG - Intronic
1075116612 10:119632158-119632180 CGCCAGGTATAGAGCCCTTGAGG + Intergenic
1075584155 10:123645045-123645067 AGCCAGGTTGTGAGCTCTGTGGG + Intergenic
1076612224 10:131733516-131733538 AGCCAGGAAGGGAGCCGTGTGGG + Intergenic
1076735203 10:132455886-132455908 AGACGGGGATGGAGCCCTGTGGG + Intergenic
1077976793 11:7254924-7254946 AGGTAGTTATAGTGCCCTGTTGG + Intronic
1078707670 11:13760652-13760674 ATCCAGCTTTAGATCCCTGTAGG - Intergenic
1079503826 11:21132443-21132465 AGCCAGGTACAGAGCGGTGAGGG + Intronic
1080219949 11:29890555-29890577 TGTCAGGTATAGACACCTGTGGG - Intergenic
1084676742 11:70639814-70639836 AGCCAGGTAAAGACCCCTTGGGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1087909431 11:103736154-103736176 TGCCTGGTATAGTGCCCTTTGGG - Intergenic
1088757880 11:112901714-112901736 AGCCAGGTGAAGATACCTGTGGG + Intergenic
1094166324 12:27447358-27447380 AGCCAGGTAGAGAGGTGTGTCGG - Intergenic
1095494577 12:42771155-42771177 AGCCAGGAAGAGAGCCCTGCTGG - Intergenic
1095686040 12:45034993-45035015 AGCCATGTAAAGTGCTCTGTGGG + Intronic
1097207699 12:57337292-57337314 AGCCAAGTGTATGGCCCTGTAGG - Intronic
1101777448 12:107807215-107807237 AGCTGGGTGTAGAGCCCTCTAGG - Intergenic
1102689671 12:114750512-114750534 CGCCAGGAATTGAGGCCTGTGGG - Intergenic
1104924408 12:132306414-132306436 AGCCATGCAGAGAGGCCTGTTGG + Intronic
1105212441 13:18265059-18265081 TGGCAGGGACAGAGCCCTGTGGG - Intergenic
1113643669 13:111976539-111976561 GGCCAGGAAAAGATCCCTGTAGG - Intergenic
1120458574 14:84764198-84764220 AGCAAGGTATAGACCATTGTGGG - Intergenic
1121391778 14:93582160-93582182 AGCCAGGTAAGCAGCCCTGGAGG - Intronic
1122826329 14:104372582-104372604 AGAAAGGTGTGGAGCCCTGTAGG - Intergenic
1125336843 15:38635310-38635332 AGCCAGGCAGAGAGTCCTGTGGG - Intergenic
1125653589 15:41337839-41337861 AACCAGGAAGAGAGCCCTGGGGG - Intronic
1126780637 15:52136321-52136343 AGGCATGTGTAGAGCCCTGTAGG - Intronic
1128742310 15:70092440-70092462 AGCAAGGTAAAGTGCCCAGTGGG + Intronic
1129515771 15:76156482-76156504 AGCCAGGGAGAGAGCCCGGGAGG + Intronic
1130888136 15:88110892-88110914 GGCCAGGTCCAGAGCCATGTGGG + Intronic
1134040117 16:11061960-11061982 AGCCAGCTACACAGCCCTGATGG + Intronic
1134392024 16:13828973-13828995 AAGTAGGTAGAGAGCCCTGTAGG - Intergenic
1134412949 16:14018467-14018489 AGCCAGATACAGAACCATGTTGG - Intergenic
1138024415 16:53511591-53511613 AGCCAGGTGGTGAGCCCTCTGGG + Intergenic
1141094467 16:81153288-81153310 ACCCAGGTCTTGATCCCTGTAGG - Intergenic
1141670351 16:85488425-85488447 AGCCATGCAGAGAGCCCCGTAGG - Intergenic
1141864386 16:86740283-86740305 AGCCAGGCACGGAGGCCTGTTGG + Intergenic
1145741837 17:27281298-27281320 AGCCAGGTATAGAGCCCTGTTGG - Intergenic
1145745941 17:27319798-27319820 AGCCAGGGGTAGAGTCCAGTGGG - Intergenic
1147433628 17:40391992-40392014 AGCCAGGATTAGAACCCAGTTGG + Intronic
1149379985 17:56084052-56084074 AGCCCATTATATAGCCCTGTGGG + Intergenic
1152748869 17:82053361-82053383 AGCCTGGTACGGAGCCCAGTGGG + Exonic
1158090984 18:53713300-53713322 AGACAGGGATAGAGCTCTCTGGG - Intergenic
1159437017 18:68431454-68431476 AGTCAGGTGTAGCGCCCTCTTGG + Intergenic
1159886112 18:73908938-73908960 AGCCAGGGAGTGAGCCCTGGAGG - Intergenic
1168412424 19:56148025-56148047 AGCCTGGCTTAGAGTCCTGTCGG + Intronic
927759733 2:25742273-25742295 AGCCAGGTATCTAGCAATGTAGG - Exonic
932906914 2:75763904-75763926 AGTCAAGTATAGTGCCCTGGTGG - Intergenic
933945290 2:87281046-87281068 AGCCAGGTAAAAAGCCTTATGGG + Intergenic
934301183 2:91777343-91777365 TGGCAGGGACAGAGCCCTGTGGG + Intergenic
937056693 2:118943602-118943624 AACCAGGTGTAGAGCCCTGGAGG + Intronic
937375354 2:121332493-121332515 GGCCAGGTGGCGAGCCCTGTAGG + Intergenic
937669823 2:124526548-124526570 AGACAGGTATAGAGCCTTGCAGG - Intronic
937776408 2:125781949-125781971 AGCCTGGAACAGACCCCTGTGGG - Intergenic
939695790 2:145322509-145322531 AGACAGGTAAAGAGCCATCTCGG - Intergenic
947149240 2:227098037-227098059 AGCCTGGGAAAGAGTCCTGTTGG - Intronic
948024649 2:234767399-234767421 AGCCAGGTCTCCTGCCCTGTGGG + Intergenic
948802498 2:240439258-240439280 AGCCAGGTATAAAGCCAGGAAGG - Intronic
948808660 2:240463721-240463743 TGCCAGGGAGGGAGCCCTGTGGG + Intronic
1169501400 20:6164232-6164254 AGCCACTTATTGAGCACTGTAGG - Intergenic
1180815256 22:18785378-18785400 TGGCAGGGACAGAGCCCTGTGGG - Intergenic
1181201446 22:21219715-21219737 TGGCAGGGACAGAGCCCTGTGGG - Intronic
1181700302 22:24617248-24617270 TGGCAGGGACAGAGCCCTGTGGG + Intronic
1182620766 22:31617255-31617277 AGCCGGGTAGAGAGCCATGGTGG - Intronic
1182762205 22:32731689-32731711 GACCAGGTATAGAGACTTGTGGG + Intronic
1183029442 22:35092405-35092427 AGTGAGGAATAGAGCCCAGTGGG - Intergenic
1183734378 22:39635777-39635799 ATCCAGGGAAAGAGCCCTGTGGG - Intronic
1203225468 22_KI270731v1_random:75715-75737 TGGCAGGGACAGAGCCCTGTGGG + Intergenic
1203265362 22_KI270734v1_random:11069-11091 TGGCAGGGACAGAGCCCTGTGGG - Intergenic
950107838 3:10399447-10399469 AGTGAGGTATAGAGACCTGCAGG - Intronic
951467656 3:23019934-23019956 AGCAGGGGAAAGAGCCCTGTAGG + Intergenic
951782704 3:26382199-26382221 AGACAGGTCTAGAACCCTGATGG + Intergenic
952492656 3:33886917-33886939 AGCCAGGGATGGTGCACTGTTGG + Intergenic
954870865 3:53766630-53766652 AGCCTGCTTGAGAGCCCTGTGGG + Intronic
958186956 3:90134282-90134304 AGCCATGCATAAAGTCCTGTTGG + Intergenic
961060768 3:123826230-123826252 AGCCTGAGATATAGCCCTGTGGG + Intronic
963179524 3:142339104-142339126 AGCCAGGTATGGCGGGCTGTGGG + Intronic
964970819 3:162558173-162558195 AGCCAGAAATAGAGGCCTCTGGG - Intergenic
967282091 3:187832744-187832766 AGAAAGATATAGAGACCTGTGGG - Intergenic
968651684 4:1762658-1762680 TGCCAGGTTTAGACCCCTGCAGG - Intergenic
969179364 4:5425122-5425144 AGCCAGGCACAGAGCCATGAGGG - Intronic
969444945 4:7239364-7239386 AACCAGGTATAGAGACCAGCAGG - Intronic
974386586 4:61207907-61207929 AGCCACATAAAGAGCCATGTAGG + Intronic
980703249 4:136458545-136458567 AGCCAGGCATAGAGCAGTGAAGG - Intergenic
980833426 4:138158984-138159006 AGTTAGGCATAGAGTCCTGTTGG + Intergenic
980978014 4:139629583-139629605 AGCCAGGAAGAGAGGCCTGCTGG - Intergenic
981257918 4:142685209-142685231 AGGCAAGTATAGAACTCTGTTGG - Intronic
983092777 4:163524255-163524277 AGACTGGTAGAAAGCCCTGTAGG + Intergenic
986872977 5:12072243-12072265 TCTCAGCTATAGAGCCCTGTGGG + Intergenic
991318373 5:65338678-65338700 AGCCAGGAATATAGCCCCATGGG + Intronic
997659720 5:135579758-135579780 AGCCAGGTAGAGAGCCCTAGTGG + Intergenic
1003074231 6:2969988-2970010 AGCCAGGTATGGAGCCCGGGAGG + Intronic
1009566472 6:65317728-65317750 AGCAAGGAATTGAGCTCTGTCGG - Intronic
1014946956 6:127510318-127510340 ACCCAGAAATAGAGCCCTGAAGG + Intronic
1016639043 6:146327719-146327741 AGCCTGGAGAAGAGCCCTGTAGG - Intronic
1019138910 6:169930919-169930941 AGCCAGGCCTAGAATCCTGTGGG - Intergenic
1021097380 7:16548658-16548680 AGCCAGGCACAGAGCACTGAGGG - Intronic
1021485533 7:21164699-21164721 AGCCAGGTATAGAGGTATGATGG + Intergenic
1022121328 7:27311047-27311069 AACAAGGTATGGAGCCATGTAGG - Intergenic
1022817588 7:33928316-33928338 AGCCAGGGATCGAGCCCCGTGGG - Intronic
1023057082 7:36299250-36299272 AGCCAAGGAATGAGCCCTGTGGG + Exonic
1034198426 7:149265455-149265477 AACCAGGAAAAGAGCCCTGCCGG - Intronic
1035240990 7:157529113-157529135 ATCCAAGTGTAGAGCCGTGTTGG + Intergenic
1040836616 8:51738099-51738121 AGCCTGCTAGAAAGCCCTGTGGG - Intronic
1051873044 9:21761254-21761276 AGACAGGTATAGAGCAGTGTGGG - Intergenic
1057439427 9:95072267-95072289 AGCCAGATATTGAGCACTTTTGG - Intronic
1058896574 9:109405732-109405754 AGCCAGGCATGGTGCCATGTGGG - Intronic
1059585815 9:115605232-115605254 AGACAGGGATGGAGCCATGTAGG + Intergenic
1060232773 9:121837991-121838013 AGCGAGAGAGAGAGCCCTGTGGG - Intronic
1188769245 X:34131724-34131746 AGCCTGGTAAACATCCCTGTGGG - Exonic
1189007191 X:37008940-37008962 AGCCTGGTAAATACCCCTGTGGG + Exonic
1189041306 X:37543787-37543809 AGCCTGGTAAATACCCCTGTGGG - Intronic
1189077810 X:37936573-37936595 AGCCAGCTATTGAGGACTGTAGG + Intronic
1190372251 X:49753871-49753893 AGCCAGGTAGAGAGACCAGATGG - Intergenic
1191849499 X:65575527-65575549 GGCCTGGGATAGAGACCTGTGGG + Intergenic