ID: 1145749712

View in Genome Browser
Species Human (GRCh38)
Location 17:27346585-27346607
Sequence CTCACTTCTGAAACCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145749712_1145749719 16 Left 1145749712 17:27346585-27346607 CCTCCAAAGGTTTCAGAAGTGAG No data
Right 1145749719 17:27346624-27346646 CCCTCTCATTTTCCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145749712 Original CRISPR CTCACTTCTGAAACCTTTGG AGG (reversed) Intergenic
No off target data available for this crispr