ID: 1145757845

View in Genome Browser
Species Human (GRCh38)
Location 17:27405760-27405782
Sequence TGCCCTTGCTTGGACTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145757845_1145757850 24 Left 1145757845 17:27405760-27405782 CCTGGGAAGTCCAAGCAAGGGCA No data
Right 1145757850 17:27405807-27405829 CTCAAACAAGGTCTTCAGAGTGG No data
1145757845_1145757848 12 Left 1145757845 17:27405760-27405782 CCTGGGAAGTCCAAGCAAGGGCA No data
Right 1145757848 17:27405795-27405817 TTGGATCCAGAGCTCAAACAAGG No data
1145757845_1145757847 -7 Left 1145757845 17:27405760-27405782 CCTGGGAAGTCCAAGCAAGGGCA No data
Right 1145757847 17:27405776-27405798 AAGGGCAATTCAGACATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145757845 Original CRISPR TGCCCTTGCTTGGACTTCCC AGG (reversed) Intergenic
No off target data available for this crispr